Clone IP01960 Report

Search the DGRC for IP01960

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:19
Well:60
Vector:pOT2
Associated Gene/Transcriptmsopa-RA
Protein status:IP01960.pep: validated not full length
Preliminary Size:496
Sequenced Size:363

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG14560 2005-01-01 Successful iPCR screen
msopa 2008-04-29 Release 5.5 accounting
msopa 2008-08-15 Release 5.9 accounting
msopa 2008-12-18 5.12 accounting

Clone Sequence Records

IP01960.complete Sequence

363 bp (363 high quality bases) assembled on 2005-03-04

GenBank Submission: BT023369

> IP01960.complete
TCATACAGATCGCCGTGCTGTTCGTCCTGGTCGCAGTGGCCTTGGCCAGA
CCACAGGAAGATCCGGCAAATCTGCCAGCTCCAGAGGCAGCAGCAGCACC
ACCAGCAGCAGCAGCAGCACCACCAGCAGCAGCAGCAGCACCACCAGCAC
CACCAGCACCACCAGCTGCAGCACCTCAAGCCGCTCCAGCGGGTGGTTCC
GGTAGAAAGAAAAATGTCAATCACAACGTCATAACCATTGGATAAAATTC
TTCGAAAGGAAGGAGGCCACAATCTTGATTTAAGAACCCATTGGTACACC
CATATTACACGCACTGCGTTAATAAATTATTTTCATTTGCGTCGCAAAAA
AAAAAAAAAAAAA

IP01960.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 20:51:05
Subject Length Description Subject Range Query Range Score Percent Strand
msopa-RA 377 msopa-RA 33..377 1..345 1725 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 13:03:26
Subject Length Description Subject Range Query Range Score Percent Strand
chr3L 24539361 chr3L 22071775..22072119 1..345 1725 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:32:52 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 13:03:25
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 22082840..22083186 1..347 1735 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:10:39
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28103327 3L 22075940..22076286 1..347 1735 100 Plus
Blast to na_te.dros performed 2019-03-16 13:03:25
Subject Length Description Subject Range Query Range Score Percent Strand
blood 7410 blood BLOOD 7410bp 5674..5771 203..292 103 60.2 Plus

IP01960.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 13:04:19 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
chr3L 22071948..22072119 174..345 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:16:15 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 8..252 1..245 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:46:58 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 8..252 1..245 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 17:14:39 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 8..252 1..245 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:28:02 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 8..252 1..245 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 11:12:31 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 8..252 1..245 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 00:56:12 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 33..377 1..345 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:46:57 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 33..377 1..345 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:14:39 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 33..377 1..345 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:28:02 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 33..377 1..345 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 11:12:31 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
msopa-RA 33..377 1..345 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
3L 22082840..22083184 1..345 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
3L 22082840..22083184 1..345 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
3L 22082840..22083184 1..345 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:14:39 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 22075940..22076284 1..345 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:02:29 Download gff for IP01960.complete
Subject Subject Range Query Range Percent Splice Strand
3L 22075940..22076284 1..345 100   Plus

IP01960.pep Sequence

Translation from 2 to 244

> IP01960.pep
IQIAVLFVLVAVALARPQEDPANLPAPEAAAAPPAAAAAPPAAAAAPPAP
PAPPAAAPQAAPAGGSGRKKNVNHNVITIG*

IP01960.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:25:31
Subject Length Description Subject Range Query Range Score Percent Strand
msopa-PB 83 CG14560-PB 4..83 1..80 402 100 Plus
msopa-PA 83 CG14560-PA 4..83 1..80 402 100 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 22:40:54
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM22431-PA 67 GM22431-PA 4..67 1..80 163 67.5 Plus

IP01960.hyp Sequence

Translation from 2 to 244

> IP01960.hyp
IQIAVLFVLVAVALARPQEDPANLPAPEAAAAPPAAAAAPPAAAAAPPAP
PAPPAAAPQAAPAGGSGRKKNVNHNVITIG*

IP01960.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 11:40:54
Subject Length Description Subject Range Query Range Score Percent Strand
msopa-PB 83 CG14560-PB 4..83 1..80 402 100 Plus
msopa-PA 83 CG14560-PA 4..83 1..80 402 100 Plus