IP01960.complete Sequence
363 bp (363 high quality bases) assembled on 2005-03-04
GenBank Submission: BT023369
> IP01960.complete
TCATACAGATCGCCGTGCTGTTCGTCCTGGTCGCAGTGGCCTTGGCCAGA
CCACAGGAAGATCCGGCAAATCTGCCAGCTCCAGAGGCAGCAGCAGCACC
ACCAGCAGCAGCAGCAGCACCACCAGCAGCAGCAGCAGCACCACCAGCAC
CACCAGCACCACCAGCTGCAGCACCTCAAGCCGCTCCAGCGGGTGGTTCC
GGTAGAAAGAAAAATGTCAATCACAACGTCATAACCATTGGATAAAATTC
TTCGAAAGGAAGGAGGCCACAATCTTGATTTAAGAACCCATTGGTACACC
CATATTACACGCACTGCGTTAATAAATTATTTTCATTTGCGTCGCAAAAA
AAAAAAAAAAAAA
IP01960.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 20:51:05
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
msopa-RA | 377 | msopa-RA | 33..377 | 1..345 | 1725 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 13:03:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr3L | 24539361 | chr3L | 22071775..22072119 | 1..345 | 1725 | 100 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:32:52 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 13:03:25
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 22082840..22083186 | 1..347 | 1735 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:10:39
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28103327 | 3L | 22075940..22076286 | 1..347 | 1735 | 100 | Plus |
Blast to na_te.dros performed 2019-03-16 13:03:25
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
blood | 7410 | blood BLOOD 7410bp | 5674..5771 | 203..292 | 103 | 60.2 | Plus |
IP01960.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 13:04:19 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr3L | 22071948..22072119 | 174..345 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:16:15 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 8..252 | 1..245 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:46:58 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 8..252 | 1..245 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 17:14:39 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 8..252 | 1..245 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:28:02 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 8..252 | 1..245 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 11:12:31 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 8..252 | 1..245 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 00:56:12 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 33..377 | 1..345 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:46:57 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 33..377 | 1..345 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:14:39 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 33..377 | 1..345 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:28:02 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 33..377 | 1..345 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 11:12:31 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
msopa-RA | 33..377 | 1..345 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 22082840..22083184 | 1..345 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 22082840..22083184 | 1..345 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 13:04:19 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 22082840..22083184 | 1..345 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:14:39 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 22075940..22076284 | 1..345 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:02:29 Download gff for
IP01960.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 22075940..22076284 | 1..345 | 100 | | Plus |
IP01960.pep Sequence
Translation from 2 to 244
> IP01960.pep
IQIAVLFVLVAVALARPQEDPANLPAPEAAAAPPAAAAAPPAAAAAPPAP
PAPPAAAPQAAPAGGSGRKKNVNHNVITIG*
IP01960.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:25:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
msopa-PB | 83 | CG14560-PB | 4..83 | 1..80 | 402 | 100 | Plus |
msopa-PA | 83 | CG14560-PA | 4..83 | 1..80 | 402 | 100 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 22:40:54
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM22431-PA | 67 | GM22431-PA | 4..67 | 1..80 | 163 | 67.5 | Plus |
IP01960.hyp Sequence
Translation from 2 to 244
> IP01960.hyp
IQIAVLFVLVAVALARPQEDPANLPAPEAAAAPPAAAAAPPAAAAAPPAP
PAPPAAAPQAAPAGGSGRKKNVNHNVITIG*
IP01960.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 11:40:54
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
msopa-PB | 83 | CG14560-PB | 4..83 | 1..80 | 402 | 100 | Plus |
msopa-PA | 83 | CG14560-PA | 4..83 | 1..80 | 402 | 100 | Plus |