Clone IP04268 Report

Search the DGRC for IP04268

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:42
Well:68
Vector:pOT2
Associated Gene/TranscriptCG13838-RA
Protein status:IP04268.pep: gold
Preliminary Size:430
Sequenced Size:437

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG13838 2005-01-01 Successful iPCR screen
CG13838 2008-04-29 Release 5.5 accounting
CG13838 2008-08-15 Release 5.9 accounting
CG13838 2008-12-18 5.12 accounting

Clone Sequence Records

IP04268.complete Sequence

437 bp (437 high quality bases) assembled on 2004-12-17

GenBank Submission: BT023679

> IP04268.complete
ATAACACCGAAAATCATGATTTAGGGTGAAAAAAATTTAAATTTAAATCG
AAAGTTGTTTTCCCAGCCCTTAAAGCCCAGATGGACAGCGCCGATGAGCA
GCTGCAGCTGGATCTGGACAGGATATCGATGGAGAGTCGCCAGGCCAGCA
GTTTCGATGACCTCATCGAGCTGACCAACAACTCGGAGCGTCTGATGGCC
AGAGTCAATTCCAGCTTGGATGACCTAAACACCGCCCTCGACAACCTGGA
GGCTCGAACGGACCGGGTTCTGGTCGAGATTCGGAGGCTAATCAGCTCGG
AAATGCCGGCACAAGGTCCGCACGATGGATGTGGCGATCCAGATGCCAGG
GCGTAGGCGGGCGAATGGCTGTGATACGTAATGTGATAATAAATAAATGT
ATTTTATTTTCATATCGAAAAAAAAAAAAAAAAAAAA

IP04268.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 17:05:57
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-RA 430 CG13838-RA 13..430 1..418 2090 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 20:09:34
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 18865667..18866085 1..417 1955 98.3 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:41:39 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 20:09:32
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23042253..23042672 1..420 2100 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:00:36
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 22783084..22783503 1..420 2100 100 Plus
Blast to na_te.dros performed on 2019-03-15 20:09:32 has no hits.

IP04268.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 20:10:37 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 18865667..18866085 1..417 98   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:23:32 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 81..356 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:06:27 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 81..356 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 03:03:43 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 81..356 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:15:14 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 81..356 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:30:05 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 81..356 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:34:32 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 13..429 1..417 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:06:27 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 13..429 1..417 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 03:03:43 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 13..429 1..417 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:15:14 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 13..429 1..417 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:30:05 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 13..429 1..417 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
3R 23042253..23042669 1..417 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
3R 23042253..23042669 1..417 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
3R 23042253..23042669 1..417 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 03:03:43 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18867975..18868391 1..417 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:39:53 Download gff for IP04268.complete
Subject Subject Range Query Range Percent Splice Strand
3R 22783084..22783500 1..417 100   Plus

IP04268.hyp Sequence

Translation from 80 to 355

> IP04268.hyp
MDSADEQLQLDLDRISMESRQASSFDDLIELTNNSERLMARVNSSLDDLN
TALDNLEARTDRVLVEIRRLISSEMPAQGPHDGCGDPDARA*

IP04268.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:25:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-PA 91 CG13838-PA 1..91 1..91 453 100 Plus

IP04268.pep Sequence

Translation from 80 to 355

> IP04268.pep
MDSADEQLQLDLDRISMESRQASSFDDLIELTNNSERLMARVNSSLDDLN
TALDNLEARTDRVLVEIRRLISSEMPAQGPHDGCGDPDARA*

IP04268.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 08:19:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF16721-PA 94 GF16721-PA 11..89 7..86 215 58 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 08:19:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG11180-PA 93 GG11180-PA 1..93 1..91 362 79.6 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:41:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-PA 91 CG13838-PA 1..91 1..91 453 100 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 08:19:10
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL27121-PA 97 GL27121-PA 1..95 1..89 136 42.1 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 08:19:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA12561-PA 97 GA12561-PA 1..95 1..89 135 42.1 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 08:19:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM26479-PA 89 GM26479-PA 3..89 5..91 319 72.4 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 08:19:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD15178-PA 91 GD15178-PA 1..91 1..91 340 74.7 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 08:19:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE10345-PA 92 GE10345-PA 1..92 1..91 377 83.7 Plus