IP04268.complete Sequence
437 bp (437 high quality bases) assembled on 2004-12-17
GenBank Submission: BT023679
> IP04268.complete
ATAACACCGAAAATCATGATTTAGGGTGAAAAAAATTTAAATTTAAATCG
AAAGTTGTTTTCCCAGCCCTTAAAGCCCAGATGGACAGCGCCGATGAGCA
GCTGCAGCTGGATCTGGACAGGATATCGATGGAGAGTCGCCAGGCCAGCA
GTTTCGATGACCTCATCGAGCTGACCAACAACTCGGAGCGTCTGATGGCC
AGAGTCAATTCCAGCTTGGATGACCTAAACACCGCCCTCGACAACCTGGA
GGCTCGAACGGACCGGGTTCTGGTCGAGATTCGGAGGCTAATCAGCTCGG
AAATGCCGGCACAAGGTCCGCACGATGGATGTGGCGATCCAGATGCCAGG
GCGTAGGCGGGCGAATGGCTGTGATACGTAATGTGATAATAAATAAATGT
ATTTTATTTTCATATCGAAAAAAAAAAAAAAAAAAAA
IP04268.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 17:05:57
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG13838-RA | 430 | CG13838-RA | 13..430 | 1..418 | 2090 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-15 20:09:34
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr3R | 27901430 | chr3R | 18865667..18866085 | 1..417 | 1955 | 98.3 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:41:39 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 20:09:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 23042253..23042672 | 1..420 | 2100 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:00:36
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 31820162 | 3R | 22783084..22783503 | 1..420 | 2100 | 100 | Plus |
Blast to na_te.dros performed on 2019-03-15 20:09:32 has no hits.
IP04268.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 20:10:37 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr3R | 18865667..18866085 | 1..417 | 98 | | Plus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:23:32 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 1..276 | 81..356 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:06:27 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 1..276 | 81..356 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 03:03:43 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 1..276 | 81..356 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:15:14 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 1..276 | 81..356 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:30:05 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 1..276 | 81..356 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:34:32 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 13..429 | 1..417 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:06:27 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 13..429 | 1..417 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 03:03:43 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 13..429 | 1..417 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:15:14 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 13..429 | 1..417 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:30:05 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG13838-RA | 13..429 | 1..417 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 23042253..23042669 | 1..417 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 23042253..23042669 | 1..417 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 20:10:37 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 23042253..23042669 | 1..417 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 03:03:43 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 18867975..18868391 | 1..417 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:39:53 Download gff for
IP04268.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 22783084..22783500 | 1..417 | 100 | | Plus |
IP04268.hyp Sequence
Translation from 80 to 355
> IP04268.hyp
MDSADEQLQLDLDRISMESRQASSFDDLIELTNNSERLMARVNSSLDDLN
TALDNLEARTDRVLVEIRRLISSEMPAQGPHDGCGDPDARA*
IP04268.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:25:25
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG13838-PA | 91 | CG13838-PA | 1..91 | 1..91 | 453 | 100 | Plus |
IP04268.pep Sequence
Translation from 80 to 355
> IP04268.pep
MDSADEQLQLDLDRISMESRQASSFDDLIELTNNSERLMARVNSSLDDLN
TALDNLEARTDRVLVEIRRLISSEMPAQGPHDGCGDPDARA*
IP04268.pep Blast Records
Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 08:19:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dana\GF16721-PA | 94 | GF16721-PA | 11..89 | 7..86 | 215 | 58 | Plus |
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 08:19:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG11180-PA | 93 | GG11180-PA | 1..93 | 1..91 | 362 | 79.6 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:41:33
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG13838-PA | 91 | CG13838-PA | 1..91 | 1..91 | 453 | 100 | Plus |
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 08:19:10
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dper\GL27121-PA | 97 | GL27121-PA | 1..95 | 1..89 | 136 | 42.1 | Plus |
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 08:19:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dpse\GA12561-PA | 97 | GA12561-PA | 1..95 | 1..89 | 135 | 42.1 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 08:19:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM26479-PA | 89 | GM26479-PA | 3..89 | 5..91 | 319 | 72.4 | Plus |
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 08:19:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsim\GD15178-PA | 91 | GD15178-PA | 1..91 | 1..91 | 340 | 74.7 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 08:19:12
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE10345-PA | 92 | GE10345-PA | 1..92 | 1..91 | 377 | 83.7 | Plus |