Clone IP04475 Report

Search the DGRC for IP04475

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:44
Well:75
Vector:pOT2
Associated Gene/TranscriptCG30430-RA
Protein status:IP04475.pep: gold
Preliminary Size:425
Sequenced Size:383

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG30430 2005-01-01 Successful iPCR screen
CG30430 2008-04-29 Release 5.5 accounting
CG30430 2008-08-15 Release 5.9 accounting
CG30430 2008-12-18 5.12 accounting

Clone Sequence Records

IP04475.complete Sequence

383 bp (383 high quality bases) assembled on 2005-01-04

GenBank Submission: BT023672

> IP04475.complete
ACAACATCAAAATTTATTGTTAATTGTCAAAGTTTTTGGAGATTTGTTTT
TTAAAACTCACATAAATTCGTGATGTGTTGCGGGCCCTGCTGTGGAACTT
GCTACTACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCA
CGATGCGGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATG
CTGCAGCAGCTGCGGACCGTCTTGTTAATTTTGGTACTCGGTAACCAAAA
CTTTTTGAAGACAATTATTTATTAACATGGCCTATTCGTCTTGAAAACAA
GATCAAGTCGTAATAAAGGTGTTTGACTTTCAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

IP04475.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 17:04:00
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RA 533 CG30430-RA 87..417 1..331 1655 100 Plus
CG30430.a 698 CG30430.a 87..417 1..331 1655 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 15:50:55
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 21015523..21015804 50..331 1395 99.6 Plus
chr2R 21145070 chr2R 21015418..21015471 1..54 270 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:42:25 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 15:50:53
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129588..25129869 50..331 1395 99.6 Plus
2R 25286936 2R 25129483..25129536 1..54 270 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:59:06
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 25130787..25131068 50..331 1395 99.6 Plus
2R 25260384 2R 25130682..25130735 1..54 270 100 Plus
Blast to na_te.dros performed on 2019-03-15 15:50:54 has no hits.

IP04475.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 15:52:14 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 21015418..21015471 1..54 100 -> Plus
chr2R 21015528..21015804 55..331 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:24:10 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 73..228 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:03:02 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 73..228 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 01:43:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 73..228 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:03:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 73..228 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:18:34 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 73..228 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:28:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 52..382 1..331 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:03:02 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 52..382 1..331 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:43:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 52..382 1..331 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:03:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 52..382 1..331 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:18:34 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 52..382 1..331 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25129483..25129536 1..54 100 -> Plus
2R 25129593..25129869 55..331 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25129483..25129536 1..54 100 -> Plus
2R 25129593..25129869 55..331 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25129483..25129536 1..54 100 -> Plus
2R 25129593..25129869 55..331 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:43:24 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017006..21017059 1..54 100 -> Plus
arm_2R 21017116..21017392 55..331 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:37:28 Download gff for IP04475.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25130700..25130753 1..54 100 -> Plus
2R 25130810..25131086 55..331 100   Plus

IP04475.hyp Sequence

Translation from 72 to 227

> IP04475.hyp
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
C*

IP04475.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:27:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PB 51 CG30430-PB 1..51 1..51 351 100 Plus
CG30430-PA 51 CG30430-PA 1..51 1..51 351 100 Plus
Mst84Dd-PA 72 CG17935-PA 7..57 4..51 169 58.5 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..47 162 56.4 Plus
Mst84Dc-PA 55 CG17945-PA 1..53 1..47 162 56.4 Plus
Mst84Dd-PA 72 CG17935-PA 24..58 2..40 144 61.9 Plus

IP04475.pep Sequence

Translation from 72 to 227

> IP04475.pep
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
C*

IP04475.pep Blast Records

Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 07:12:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG23032-PA 51 GG23032-PA 1..51 1..51 214 100 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:22:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PB 51 CG30430-PB 1..51 1..51 351 100 Plus
CG30430-PA 51 CG30430-PA 1..51 1..51 351 100 Plus
Mst84Dd-PA 72 CG17935-PA 7..57 4..51 169 58.5 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..47 162 56.4 Plus
Mst84Dc-PA 55 CG17945-PA 1..53 1..47 162 56.4 Plus
Pif2-PA 118 CG31483-PA 5..62 2..51 157 48.3 Plus
Pif2-PA 118 CG31483-PA 2..50 3..51 154 54 Plus
Mst84Db-PA 74 CG17934-PA 19..65 3..51 150 61.5 Plus
Mst84Dd-PA 72 CG17935-PA 24..58 2..40 144 61.9 Plus
Pif2-PA 118 CG31483-PA 9..69 2..51 143 44.3 Plus
Pif2-PA 118 CG31483-PA 37..85 2..51 143 50 Plus
Mst87F-PB 56 CG17956-PB 6..56 3..44 140 52.9 Plus
Mst87F-PA 56 CG17956-PA 6..56 3..44 140 52.9 Plus
Pif2-PA 118 CG31483-PA 33..77 2..51 139 50 Plus
Pif2-PA 118 CG31483-PA 72..115 2..50 136 53.1 Plus
Pif2-PA 118 CG31483-PA 45..105 2..51 135 41 Plus
Mst84Da-PA 63 CG17946-PA 16..63 2..51 128 50.9 Plus
Mst84Db-PA 74 CG17934-PA 31..72 2..51 127 51.9 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 07:12:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM11925-PA 51 GM11925-PA 1..51 1..51 214 100 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 07:12:10
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD11919-PA 51 GD11919-PA 1..51 1..51 214 100 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 07:12:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE14465-PA 51 GE14465-PA 1..51 1..51 214 100 Plus