IP04475.complete Sequence
383 bp (383 high quality bases) assembled on 2005-01-04
GenBank Submission: BT023672
> IP04475.complete
ACAACATCAAAATTTATTGTTAATTGTCAAAGTTTTTGGAGATTTGTTTT
TTAAAACTCACATAAATTCGTGATGTGTTGCGGGCCCTGCTGTGGAACTT
GCTACTACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCA
CGATGCGGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATG
CTGCAGCAGCTGCGGACCGTCTTGTTAATTTTGGTACTCGGTAACCAAAA
CTTTTTGAAGACAATTATTTATTAACATGGCCTATTCGTCTTGAAAACAA
GATCAAGTCGTAATAAAGGTGTTTGACTTTCAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
IP04475.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 17:04:00
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG30430-RA | 533 | CG30430-RA | 87..417 | 1..331 | 1655 | 100 | Plus |
CG30430.a | 698 | CG30430.a | 87..417 | 1..331 | 1655 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-15 15:50:55
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2R | 21145070 | chr2R | 21015523..21015804 | 50..331 | 1395 | 99.6 | Plus |
chr2R | 21145070 | chr2R | 21015418..21015471 | 1..54 | 270 | 100 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:42:25 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 15:50:53
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 25129588..25129869 | 50..331 | 1395 | 99.6 | Plus |
2R | 25286936 | 2R | 25129483..25129536 | 1..54 | 270 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:59:06
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25260384 | 2R | 25130787..25131068 | 50..331 | 1395 | 99.6 | Plus |
2R | 25260384 | 2R | 25130682..25130735 | 1..54 | 270 | 100 | Plus |
Blast to na_te.dros performed on 2019-03-15 15:50:54 has no hits.
IP04475.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 15:52:14 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2R | 21015418..21015471 | 1..54 | 100 | -> | Plus |
chr2R | 21015528..21015804 | 55..331 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:24:10 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 1..156 | 73..228 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:03:02 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 1..156 | 73..228 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 01:43:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 1..156 | 73..228 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:03:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 1..156 | 73..228 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:18:34 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 1..156 | 73..228 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:28:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 52..382 | 1..331 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:03:02 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 52..382 | 1..331 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:43:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 52..382 | 1..331 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:03:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 52..382 | 1..331 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:18:34 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG30430-RA | 52..382 | 1..331 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25129483..25129536 | 1..54 | 100 | -> | Plus |
2R | 25129593..25129869 | 55..331 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25129483..25129536 | 1..54 | 100 | -> | Plus |
2R | 25129593..25129869 | 55..331 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 15:52:14 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25129483..25129536 | 1..54 | 100 | -> | Plus |
2R | 25129593..25129869 | 55..331 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:43:24 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 21017006..21017059 | 1..54 | 100 | -> | Plus |
arm_2R | 21017116..21017392 | 55..331 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:37:28 Download gff for
IP04475.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25130700..25130753 | 1..54 | 100 | -> | Plus |
2R | 25130810..25131086 | 55..331 | 100 | | Plus |
IP04475.hyp Sequence
Translation from 72 to 227
> IP04475.hyp
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
C*
IP04475.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:27:08
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG30430-PB | 51 | CG30430-PB | 1..51 | 1..51 | 351 | 100 | Plus |
CG30430-PA | 51 | CG30430-PA | 1..51 | 1..51 | 351 | 100 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 7..57 | 4..51 | 169 | 58.5 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 1..53 | 1..47 | 162 | 56.4 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 1..53 | 1..47 | 162 | 56.4 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 24..58 | 2..40 | 144 | 61.9 | Plus |
IP04475.pep Sequence
Translation from 72 to 227
> IP04475.pep
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
C*
IP04475.pep Blast Records
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 07:12:07
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG23032-PA | 51 | GG23032-PA | 1..51 | 1..51 | 214 | 100 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:22:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG30430-PB | 51 | CG30430-PB | 1..51 | 1..51 | 351 | 100 | Plus |
CG30430-PA | 51 | CG30430-PA | 1..51 | 1..51 | 351 | 100 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 7..57 | 4..51 | 169 | 58.5 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 1..53 | 1..47 | 162 | 56.4 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 1..53 | 1..47 | 162 | 56.4 | Plus |
Pif2-PA | 118 | CG31483-PA | 5..62 | 2..51 | 157 | 48.3 | Plus |
Pif2-PA | 118 | CG31483-PA | 2..50 | 3..51 | 154 | 54 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 19..65 | 3..51 | 150 | 61.5 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 24..58 | 2..40 | 144 | 61.9 | Plus |
Pif2-PA | 118 | CG31483-PA | 9..69 | 2..51 | 143 | 44.3 | Plus |
Pif2-PA | 118 | CG31483-PA | 37..85 | 2..51 | 143 | 50 | Plus |
Mst87F-PB | 56 | CG17956-PB | 6..56 | 3..44 | 140 | 52.9 | Plus |
Mst87F-PA | 56 | CG17956-PA | 6..56 | 3..44 | 140 | 52.9 | Plus |
Pif2-PA | 118 | CG31483-PA | 33..77 | 2..51 | 139 | 50 | Plus |
Pif2-PA | 118 | CG31483-PA | 72..115 | 2..50 | 136 | 53.1 | Plus |
Pif2-PA | 118 | CG31483-PA | 45..105 | 2..51 | 135 | 41 | Plus |
Mst84Da-PA | 63 | CG17946-PA | 16..63 | 2..51 | 128 | 50.9 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 31..72 | 2..51 | 127 | 51.9 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 07:12:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM11925-PA | 51 | GM11925-PA | 1..51 | 1..51 | 214 | 100 | Plus |
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 07:12:10
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsim\GD11919-PA | 51 | GD11919-PA | 1..51 | 1..51 | 214 | 100 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 07:12:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE14465-PA | 51 | GE14465-PA | 1..51 | 1..51 | 214 | 100 | Plus |