Clone IP05510 Report

Search the DGRC for IP05510

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:55
Well:10
Vector:pOT2
Associated Gene/TranscriptCG11373-RA
Protein status:IP05510.pep: gold
Preliminary Size:328
Sequenced Size:375

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG11373 2005-01-01 Successful iPCR screen
CG11373 2008-04-29 Release 5.5 accounting
CG11373 2008-08-15 Release 5.9 accounting
CG11373 2008-12-18 5.12 accounting

Clone Sequence Records

IP05510.complete Sequence

375 bp (375 high quality bases) assembled on 2006-01-26

GenBank Submission: BT024385

> IP05510.complete
ACTGTCAATAGTCTCAGACAATTTTCGTAACGCGCCGCTAAAATGCCCGA
AAAACCATCAGCAAAGTCGGCTCCGAGGCCCCTGACCAGCATAAAGGGGA
CCAGGCCCTCCACATCCTCATCCAATCCCACCACCAGCAGGAGCAAACCC
ACAGGAACTGGAGTGGTTCGACCACCATTGCCAAATGCACACGATAGGAT
TTGGAAGATTATGAAGATGTAATAATATCTAAAAATATTCGGTCCCCAAA
TTGGATCCACGTTTTAAATCCTGATATTCTTTTTTTATAAAATGTACGGA
TTCTTTGACGTCTAAAGCGCTGAATAAAGCGAATAAATCCCAAAAGGGAA
ATTACTCTTAAAAAAAAAAAAAAAA

IP05510.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 17:19:10
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 512 CG11373-RA 154..512 1..359 1795 100 Plus
CG11373.a 298 CG11373.a 32..274 1..243 1215 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 14:21:41
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 1786404..1786601 198..1 990 100 Minus
chr3R 27901430 chr3R 1785908..1786026 359..241 595 100 Minus
chr3R 27901430 chr3R 1786075..1786120 243..198 230 100 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:45:55 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 14:21:39
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960987 198..1 990 100 Minus
3R 32079331 3R 5960293..5960412 360..241 600 100 Minus
3R 32079331 3R 5960461..5960506 243..198 230 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:11:55
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 5701621..5701818 198..1 990 100 Minus
3R 31820162 3R 5701124..5701243 360..241 600 100 Minus
3R 31820162 3R 5701292..5701337 243..198 230 100 Minus
Blast to na_te.dros performed 2019-03-16 14:21:40
Subject Length Description Subject Range Query Range Score Percent Strand
accord2 7650 accord2 QBERT 7650bp 5426..5455 209..237 102 86.7 Plus

IP05510.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 14:22:20 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 1785908..1786025 242..359 100 <- Minus
chr3R 1786077..1786119 199..241 100 <- Minus
chr3R 1786404..1786601 1..198 100   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:27:18 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 43..222 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:33:11 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 43..222 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 17:26:15 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 43..222 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 16:07:47 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 43..222 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 11:30:49 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 43..222 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 18:05:01 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..328 3..330 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:33:11 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..328 3..330 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:26:15 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..359 1..359 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 16:07:47 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..328 3..330 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 11:30:49 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..359 1..359 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5960294..5960411 242..359 100 <- Minus
3R 5960463..5960505 199..241 100 <- Minus
3R 5960790..5960987 1..198 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5960294..5960411 242..359 100 <- Minus
3R 5960463..5960505 199..241 100 <- Minus
3R 5960790..5960987 1..198 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5960294..5960411 242..359 100 <- Minus
3R 5960463..5960505 199..241 100 <- Minus
3R 5960790..5960987 1..198 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:26:15 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786016..1786133 242..359 100 <- Minus
arm_3R 1786185..1786227 199..241 100 <- Minus
arm_3R 1786512..1786709 1..198 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:57:42 Download gff for IP05510.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5701294..5701336 199..241 100 <- Minus
3R 5701125..5701242 242..359 100 <- Minus
3R 5701621..5701818 1..198 100   Minus

IP05510.pep Sequence

Translation from 42 to 221

> IP05510.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*

IP05510.pep Blast Records

Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 19:22:49
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG10699-PA 59 GG10699-PA 1..59 1..59 215 88.1 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:51:51
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 59 CG11373-PA 1..59 1..59 311 100 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 19:22:52
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM10581-PA 59 GM10581-PA 1..59 1..59 222 93.2 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 19:22:52
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD19571-PA 59 GD19571-PA 1..59 1..59 222 93.2 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 19:22:53
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE24127-PA 59 GE24127-PA 1..59 1..59 215 88.1 Plus

IP05510.hyp Sequence

Translation from 42 to 221

> IP05510.hyp
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*

IP05510.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:36:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 59 CG11373-PA 1..59 1..59 311 100 Plus