IP05510.complete Sequence
375 bp (375 high quality bases) assembled on 2006-01-26
GenBank Submission: BT024385
> IP05510.complete
ACTGTCAATAGTCTCAGACAATTTTCGTAACGCGCCGCTAAAATGCCCGA
AAAACCATCAGCAAAGTCGGCTCCGAGGCCCCTGACCAGCATAAAGGGGA
CCAGGCCCTCCACATCCTCATCCAATCCCACCACCAGCAGGAGCAAACCC
ACAGGAACTGGAGTGGTTCGACCACCATTGCCAAATGCACACGATAGGAT
TTGGAAGATTATGAAGATGTAATAATATCTAAAAATATTCGGTCCCCAAA
TTGGATCCACGTTTTAAATCCTGATATTCTTTTTTTATAAAATGTACGGA
TTCTTTGACGTCTAAAGCGCTGAATAAAGCGAATAAATCCCAAAAGGGAA
ATTACTCTTAAAAAAAAAAAAAAAA
IP05510.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 17:19:10
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 512 | CG11373-RA | 154..512 | 1..359 | 1795 | 100 | Plus |
CG11373.a | 298 | CG11373.a | 32..274 | 1..243 | 1215 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 14:21:41
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr3R | 27901430 | chr3R | 1786404..1786601 | 198..1 | 990 | 100 | Minus |
chr3R | 27901430 | chr3R | 1785908..1786026 | 359..241 | 595 | 100 | Minus |
chr3R | 27901430 | chr3R | 1786075..1786120 | 243..198 | 230 | 100 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:45:55 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 14:21:39
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960987 | 198..1 | 990 | 100 | Minus |
3R | 32079331 | 3R | 5960293..5960412 | 360..241 | 600 | 100 | Minus |
3R | 32079331 | 3R | 5960461..5960506 | 243..198 | 230 | 100 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:11:55
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 31820162 | 3R | 5701621..5701818 | 198..1 | 990 | 100 | Minus |
3R | 31820162 | 3R | 5701124..5701243 | 360..241 | 600 | 100 | Minus |
3R | 31820162 | 3R | 5701292..5701337 | 243..198 | 230 | 100 | Minus |
Blast to na_te.dros performed 2019-03-16 14:21:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
accord2 | 7650 | accord2 QBERT 7650bp | 5426..5455 | 209..237 | 102 | 86.7 | Plus |
IP05510.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 14:22:20 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr3R | 1785908..1786025 | 242..359 | 100 | <- | Minus |
chr3R | 1786077..1786119 | 199..241 | 100 | <- | Minus |
chr3R | 1786404..1786601 | 1..198 | 100 | | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 17:27:18 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 43..222 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:33:11 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 43..222 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 17:26:15 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 43..222 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 16:07:47 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 43..222 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 11:30:49 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 43..222 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 18:05:01 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..328 | 3..330 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:33:11 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..328 | 3..330 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:26:15 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..359 | 1..359 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 16:07:47 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..328 | 3..330 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 11:30:49 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..359 | 1..359 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960294..5960411 | 242..359 | 100 | <- | Minus |
3R | 5960463..5960505 | 199..241 | 100 | <- | Minus |
3R | 5960790..5960987 | 1..198 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960294..5960411 | 242..359 | 100 | <- | Minus |
3R | 5960463..5960505 | 199..241 | 100 | <- | Minus |
3R | 5960790..5960987 | 1..198 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 14:22:20 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960294..5960411 | 242..359 | 100 | <- | Minus |
3R | 5960463..5960505 | 199..241 | 100 | <- | Minus |
3R | 5960790..5960987 | 1..198 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:26:15 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786016..1786133 | 242..359 | 100 | <- | Minus |
arm_3R | 1786185..1786227 | 199..241 | 100 | <- | Minus |
arm_3R | 1786512..1786709 | 1..198 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:57:42 Download gff for
IP05510.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5701294..5701336 | 199..241 | 100 | <- | Minus |
3R | 5701125..5701242 | 242..359 | 100 | <- | Minus |
3R | 5701621..5701818 | 1..198 | 100 | | Minus |
IP05510.pep Sequence
Translation from 42 to 221
> IP05510.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*
IP05510.pep Blast Records
Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 19:22:49
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG10699-PA | 59 | GG10699-PA | 1..59 | 1..59 | 215 | 88.1 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:51:51
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 59 | CG11373-PA | 1..59 | 1..59 | 311 | 100 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 19:22:52
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM10581-PA | 59 | GM10581-PA | 1..59 | 1..59 | 222 | 93.2 | Plus |
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 19:22:52
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsim\GD19571-PA | 59 | GD19571-PA | 1..59 | 1..59 | 222 | 93.2 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 19:22:53
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE24127-PA | 59 | GE24127-PA | 1..59 | 1..59 | 215 | 88.1 | Plus |
IP05510.hyp Sequence
Translation from 42 to 221
> IP05510.hyp
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*
IP05510.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:36:38
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 59 | CG11373-PA | 1..59 | 1..59 | 311 | 100 | Plus |