Clone IP19010 Report

Search the DGRC for IP19010

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:190
Well:10
Vector:pOTB7_DraIII
Associated Gene/TranscriptCG12506-RA
Protein status:IP19010.pep: gold
Sequenced Size:498

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG12506 2008-04-29 Release 5.5 accounting
CG12506 2008-05-05 Release 5.5 slip selected
CG12506 2008-08-15 Release 5.9 accounting
CG12506 2008-12-18 5.12 accounting

Clone Sequence Records

IP19010.complete Sequence

498 bp assembled on 2007-08-02

GenBank Submission: BT030859

> IP19010.complete
ATCACAACCTGAATTTCCACTAAGCAAAGCCGAACTGCCAGAGAGAAAAT
GCGTTCCTTCATTCTGATTGCCCTCTTCGCCCTGATTGCCCTGGCTGCTG
CTCAAGGCGGACCACAAGGTGGACAGCAGGGTGGGCAAGGAGGATCTCAA
AATGGTCAGCAAGGAGGCCAGCAGGGAGGCTCCCAGGAAGGATCCCAGGA
AGGATCCCAGGAAGGACAACAGGGAGGTCAGCAGGGAGGTCAGCAGCAGG
GTGGTCCTGGCGGTCCATGGGGTCTGCCTCCGAATGGAACTGAACTCTCC
AACAGTACCACAACTTCGACCACTGAGGCTACCAGCACTGAATCCAGCAG
CACAGAGGTTTCCTCTTCGTAACTTATAGATTGATCCTAATGAAAGCGAA
CAGGCTTGCTCAGTTCCTTACCATTCCCTTTATCAATACAAGTTCTTGAA
ATAAATTGATATCAGTACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA

IP19010.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 21:17:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG12506-RA 446 CG12506-RA 1..442 29..470 2210 100 Plus
CG13946-RA 357 CG13946-RA 1..157 43..199 725 97.4 Plus
CG13946-RA 357 CG13946-RA 130..299 196..365 610 90.5 Plus
CG13947-RA 360 CG13947-RA 1..86 49..134 235 84.8 Plus
CG13946-RA 357 CG13946-RA 115..180 169..234 195 86.3 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 19:28:07
Subject Length Description Subject Range Query Range Score Percent Strand
chr2L 23010047 chr2L 773414..773883 1..470 2350 100 Plus
chr2L 23010047 chr2L 776395..776693 43..365 945 87.6 Plus
chr2L 23010047 chr2L 779053..779148 39..134 240 83.3 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 18:37:44 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 19:28:05
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 773547..774016 1..470 2350 100 Plus
2L 23513712 2L 776536..776834 43..365 975 88.2 Plus
2L 23513712 2L 779194..779289 39..134 240 83.3 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:34:48
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 773547..774016 1..470 2350 100 Plus
2L 23513712 2L 776536..776692 43..199 725 97.4 Plus
2L 23513712 2L 776665..776834 196..365 610 90.5 Plus
2L 23513712 2L 779194..779289 39..134 240 83.3 Plus
2L 23513712 2L 776650..776715 169..234 195 86.3 Plus
Blast to na_te.dros performed on 2019-03-15 19:28:05 has no hits.

IP19010.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 19:29:08 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
chr2L 773414..773593 1..180 100 == Plus
chr2L 773660..773883 247..470 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 18:13:37 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..324 49..372 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:25:41 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..324 49..372 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 04:57:32 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..324 49..372 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:09:43 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..324 49..372 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:00:41 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..324 49..372 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:31:09 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..442 29..470 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:25:40 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..442 29..470 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 04:57:32 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..470 1..470 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:09:44 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..442 29..470 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:00:41 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
CG12506-RA 1..470 1..470 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:29:08 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
2L 773547..774016 1..470 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:29:08 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
2L 773547..774016 1..470 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:29:08 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
2L 773547..774016 1..470 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 04:57:32 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 773547..774016 1..470 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:57:50 Download gff for IP19010.complete
Subject Subject Range Query Range Percent Splice Strand
2L 773547..774016 1..470 100   Plus

IP19010.pep Sequence

Translation from 48 to 371

> IP19010.pep
MRSFILIALFALIALAAAQGGPQGGQQGGQGGSQNGQQGGQQGGSQEGSQ
EGSQEGQQGGQQGGQQQGGPGGPWGLPPNGTELSNSTTTSTTEATSTESS
STEVSSS*

IP19010.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:51:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG12506-PA 107 CG12506-PA 1..107 1..107 550 100 Plus
CG13946-PA 99 CG13946-PA 1..99 1..107 465 86 Plus
CG13947-PA 119 CG13947-PA 1..113 1..107 361 67.3 Plus
lcs-PA 145 CG12794-PA 1..128 1..107 171 38 Plus
CG10918-PA 183 CG10918-PA 1..143 1..107 140 33.1 Plus

IP19010.hyp Sequence

Translation from 48 to 371

> IP19010.hyp
MRSFILIALFALIALAAAQGGPQGGQQGGQGGSQNGQQGGQQGGSQEGSQ
EGSQEGQQGGQQGGQQQGGPGGPWGLPPNGTELSNSTTTSTTEATSTESS
STEVSSS*

IP19010.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:51:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG12506-PA 107 CG12506-PA 1..107 1..107 550 100 Plus
CG13946-PA 99 CG13946-PA 1..99 1..107 465 86 Plus
CG13947-PA 119 CG13947-PA 1..113 1..107 361 67.3 Plus
lcs-PA 145 CG12794-PA 1..128 1..107 171 38 Plus
CG10918-PA 183 CG10918-PA 1..143 1..107 140 33.1 Plus