IP20364.complete Sequence
376 bp assembled on 2008-05-14
GenBank Submission: BT032727
> IP20364.complete
TTCTTTGCTCTGTGTGCCTTCCTCCTCATTGCCCTGGCTACCGTCCAGGC
AACTCCCGGTGATCTGCGCCATGTTCCTGTAGGACACGGAGGACACCCAG
TCAATGCTGGCCACGGACCTGTGGGACACGCTGGTCCTGTTGGACACGGT
CCAGTTGTAGGCCATGGTCCAGTTGTAGGCCATGGTCCAGTTGTGGGACA
TGGTGTTCATGGTCATTCTGGCTGAAAACTTATCTGAATCCTACAAGGAG
CGCAATGCAGACCTTGATGGAAAGAAACGAAGTGTTTGTTCAACACCTTC
AGTACAGCATATCCTAATAAAATATTCGATTTATCGAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA
IP20364.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 17:00:12
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG42500-RA | 344 | CG42500-RA | 9..344 | 1..336 | 1680 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 00:02:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr3R | 27901430 | chr3R | 9977061..9977396 | 336..1 | 1620 | 98.8 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 18:42:30 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:13
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 14152207..14152546 | 340..1 | 1700 | 100 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:56:03
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 31820162 | 3R | 13893038..13893377 | 340..1 | 1700 | 100 | Minus |
Blast to na_te.dros performed on 2019-03-16 00:02:13 has no hits.
IP20364.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 00:02:50 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr3R | 9977061..9977396 | 1..336 | 98 | | Minus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:55:49 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 7..231 | 1..225 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 06:47:48 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 7..231 | 1..225 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:54:56 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG7609-RA | 535..552 | 185..202 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 01:56:17 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 7..231 | 1..225 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:19:51 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14359-RA | 5..340 | 1..336 | 100 | | Minus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:55:49 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 9..344 | 1..336 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 06:47:48 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 9..344 | 1..336 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:54:56 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14359-RA | 5..340 | 1..336 | 100 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 01:56:17 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42500-RA | 9..344 | 1..336 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 14152211..14152546 | 1..336 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 14152211..14152546 | 1..336 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 14152211..14152546 | 1..336 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:47:48 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 9977933..9978268 | 1..336 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:32:44 Download gff for
IP20364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 13893042..13893377 | 1..336 | 100 | | Minus |
IP20364.pep Sequence
Translation from 0 to 224
> IP20364.pep
FFALCAFLLIALATVQATPGDLRHVPVGHGGHPVNAGHGPVGHAGPVGHG
PVVGHGPVVGHGPVVGHGVHGHSG*
IP20364.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:33:03
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG42500-PB | 76 | CG42500-PB | 3..76 | 1..74 | 419 | 100 | Plus |
CG42500-PA | 76 | CG42500-PA | 3..76 | 1..74 | 419 | 100 | Plus |
IP20364.hyp Sequence
Translation from 0 to 224
> IP20364.hyp
FFALCAFLLIALATVQATPGDLRHVPVGHGGHPVNAGHGPVGHAGPVGHG
PVVGHGPVVGHGPVVGHGVHGHSG*
IP20364.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 13:09:04
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG42500-PB | 76 | CG42500-PB | 3..76 | 1..74 | 419 | 100 | Plus |
CG42500-PA | 76 | CG42500-PA | 3..76 | 1..74 | 419 | 100 | Plus |