Clone IP20364 Report

Search the DGRC for IP20364

Clone and Library Details

Library:IP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by: 
Date Registered:2004-07-08
Comments: 
Original Plate Number:203
Well:64
Vector:pOT2
Protein status:IP20364.pep: Imported from assembly
Sequenced Size:376

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG14359 2008-05-05 Release 5.5 slip selected

Clone Sequence Records

IP20364.complete Sequence

376 bp assembled on 2008-05-14

GenBank Submission: BT032727

> IP20364.complete
TTCTTTGCTCTGTGTGCCTTCCTCCTCATTGCCCTGGCTACCGTCCAGGC
AACTCCCGGTGATCTGCGCCATGTTCCTGTAGGACACGGAGGACACCCAG
TCAATGCTGGCCACGGACCTGTGGGACACGCTGGTCCTGTTGGACACGGT
CCAGTTGTAGGCCATGGTCCAGTTGTAGGCCATGGTCCAGTTGTGGGACA
TGGTGTTCATGGTCATTCTGGCTGAAAACTTATCTGAATCCTACAAGGAG
CGCAATGCAGACCTTGATGGAAAGAAACGAAGTGTTTGTTCAACACCTTC
AGTACAGCATATCCTAATAAAATATTCGATTTATCGAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA

IP20364.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 17:00:12
Subject Length Description Subject Range Query Range Score Percent Strand
CG42500-RA 344 CG42500-RA 9..344 1..336 1680 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 00:02:14
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 9977061..9977396 336..1 1620 98.8 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 18:42:30 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:13
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 14152207..14152546 340..1 1700 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:56:03
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 13893038..13893377 340..1 1700 100 Minus
Blast to na_te.dros performed on 2019-03-16 00:02:13 has no hits.

IP20364.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 00:02:50 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 9977061..9977396 1..336 98   Minus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:55:49 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 7..231 1..225 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 06:47:48 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 7..231 1..225 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:54:56 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG7609-RA 535..552 185..202 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 01:56:17 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 7..231 1..225 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:19:51 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG14359-RA 5..340 1..336 100   Minus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:55:49 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 9..344 1..336 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 06:47:48 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 9..344 1..336 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:54:56 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG14359-RA 5..340 1..336 100   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 01:56:17 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
CG42500-RA 9..344 1..336 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14152211..14152546 1..336 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14152211..14152546 1..336 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:02:50 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14152211..14152546 1..336 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:47:48 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9977933..9978268 1..336 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:32:44 Download gff for IP20364.complete
Subject Subject Range Query Range Percent Splice Strand
3R 13893042..13893377 1..336 100   Minus

IP20364.pep Sequence

Translation from 0 to 224

> IP20364.pep
FFALCAFLLIALATVQATPGDLRHVPVGHGGHPVNAGHGPVGHAGPVGHG
PVVGHGPVVGHGPVVGHGVHGHSG*

IP20364.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:33:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG42500-PB 76 CG42500-PB 3..76 1..74 419 100 Plus
CG42500-PA 76 CG42500-PA 3..76 1..74 419 100 Plus

IP20364.hyp Sequence

Translation from 0 to 224

> IP20364.hyp
FFALCAFLLIALATVQATPGDLRHVPVGHGGHPVNAGHGPVGHAGPVGHG
PVVGHGPVVGHGPVVGHGVHGHSG*

IP20364.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 13:09:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG42500-PB 76 CG42500-PB 3..76 1..74 419 100 Plus
CG42500-PA 76 CG42500-PA 3..76 1..74 419 100 Plus