Clone LD15555 Report

Search the DGRC for LD15555

Clone and Library Details

Library:LD
Tissue Source:Drosophila melanogaster embryo
Created by:Ling Hong
Date Registered:1997-12-04
Comments:Constructed using Stratagene ZAP-cDNA Synthesis kit. Oligo dT-primed and directionally cloned at EcoRI and XhoI in BlueScript SK(+/-)
Original Plate Number:155
Well:55
Vector:pBS SK-
Associated Gene/TranscriptAtox1-RA
Protein status:LD15555.pep: gold
Preliminary Size:1086
Sequenced Size:872

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG12562 2001-01-01 Release 2 assignment
CG32446 2001-10-10 Blastp of sequenced clone
CG32446 2003-01-01 Sim4 clustering to Release 3
CG32446 2008-04-29 Release 5.5 accounting
CG32446 2008-08-15 Release 5.9 accounting
CG32446 2008-12-18 5.12 accounting

Clone Sequence Records

LD15555.complete Sequence

872 bp (872 high quality bases) assembled on 2001-10-10

GenBank Submission: AY061200

> LD15555.complete
ATTCGCTGAAAAAACGAAGGGAGTTTCTGAGTGCCACGTTTGGAACTGAG
AGTAGCCGAGGAAAGCCGTCAAGCTGTTCAACCTACCGCAAGTCTACAAG
CAGACGACGGACTCCAGAAGTCACAGCAGCAGCAGCAGCAGCAGGATGAC
AGTGCACGAATTCAAGGTGGAGATGACCTGCGGCGGATGTGCCAGTGCCG
TGGAGCGAGTCCTGGGCAAACTGGGCGATAAGGTCGAGAAAGTCAACATT
AACCTGGAGGATCGGACGGTGAGCGTGACGTCGAACCTGTCGTCCGACGA
GTTGATGGAGCAGCTGCGCAAGACCGGCAAGAGCACCACCTACGTCGGGG
TGAAGAAATGAGACGAGTTCCTCAGCAAGTTTCAGAAGTACGGCAGGCTG
AAACTTGAGGTATAGGGTGTGGACCCCAGAGGATTGAAATATCTTCCACG
TTGCCGCTCCGAAAGCATTCGATTTGGGTCGCTGTTCAGTGATATTCATG
GGATACATACAAATTTTACTCTTAACCAAATCAAATATAGGAATCATATA
CAAATTTTACCTTAGTATTTGCTCTTGCCCAAATTGTATGTAGCTCGTAG
TTAACCAATTGAGGTGTTATTATATTATGCATTACTTATGCTTAGATGAA
GAATTTTAAATTCAAATTTAACTAATCAAATCGTACAGCCAACTTTTTGC
CTAAGTATGCAGGTGCCGTATTTAGGGGTACTCAAGTAAATCCAACGTAG
TTGCCAATAAATGATATACGCCAGTTGCCCTCTTATGACTAATCGTAATA
TTACAAATTTTACCATTTTAAATATCAAATATATACAAATACATTTTAAC
CTTAAAAAAAAAAAAAAAAAAA

LD15555.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 19:44:04
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-RA 1019 Atox1-RA 158..1013 1..856 4280 100 Plus
Atox1.a 1550 Atox1.a 158..1013 1..856 4280 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 09:09:29
Subject Length Description Subject Range Query Range Score Percent Strand
chr3L 24539361 chr3L 21630909..21631535 227..853 3135 100 Plus
chr3L 24539361 chr3L 21629981..21630134 1..154 770 100 Plus
chr3L 24539361 chr3L 21630223..21630298 152..227 380 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 19:03:05 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 09:09:27
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 21641973..21642602 227..856 3150 100 Plus
3L 28110227 3L 21641045..21641198 1..154 770 100 Plus
3L 28110227 3L 21641287..21641362 152..227 380 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 21:10:50
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28103327 3L 21635073..21635702 227..856 3150 100 Plus
3L 28103327 3L 21634145..21634298 1..154 770 100 Plus
3L 28103327 3L 21634387..21634462 152..227 380 100 Plus
Blast to na_te.dros performed 2019-03-16 09:09:27
Subject Length Description Subject Range Query Range Score Percent Strand
Transpac 5249 Transpac 5249bp Derived from AF222049 (AF222049.1) (Rel. 62, Last updated, Version 1). 4006..4058 847..798 114 71.7 Minus
Rt1a 5108 Rt1a DME278684 5108bp Derived from AJ278684 (AJ278684.1) (Rel. 64, Last updated, Version 1). 316..350 653..687 112 80 Plus

LD15555.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 09:10:41 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
chr3L 21629981..21630131 1..151 100 -> Plus
chr3L 21630223..21630298 152..227 100 -> Plus
chr3L 21630910..21631535 228..853 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 18:50:12 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
CG32446-RA 1..216 146..361 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 19:10:33 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 1..216 146..361 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 08:00:21 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RB 1..270 146..415 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 19:34:43 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
CG32446-RA 1..216 146..361 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 10:01:04 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RB 1..270 146..415 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 22:40:27 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
CG32446-RA 4..856 1..853 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 19:10:33 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 4..856 1..853 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 08:00:21 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 51..903 1..853 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 19:34:43 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
CG32446-RA 4..856 1..853 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 10:01:04 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 51..903 1..853 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 09:10:41 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
3L 21641045..21641195 1..151 100 -> Plus
3L 21641287..21641362 152..227 100 -> Plus
3L 21641974..21642599 228..853 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 09:10:41 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
3L 21641045..21641195 1..151 100 -> Plus
3L 21641287..21641362 152..227 100 -> Plus
3L 21641974..21642599 228..853 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 09:10:41 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
3L 21641045..21641195 1..151 100 -> Plus
3L 21641287..21641362 152..227 100 -> Plus
3L 21641974..21642599 228..853 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 08:00:21 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 21634145..21634295 1..151 100 -> Plus
arm_3L 21634387..21634462 152..227 100 -> Plus
arm_3L 21635074..21635699 228..853 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 16:11:59 Download gff for LD15555.complete
Subject Subject Range Query Range Percent Splice Strand
3L 21635074..21635699 228..853 100   Plus
3L 21634145..21634295 1..151 100 -> Plus
3L 21634387..21634462 152..227 100 -> Plus

LD15555.hyp Sequence

Translation from 145 to 360

> LD15555.hyp
MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS
DELMEQLRKTGKSTTYVGVKK*

LD15555.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 14:04:14
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-PA 71 CG32446-PA 1..71 1..71 356 100 Plus
Atox1-PB 89 CG32446-PB 1..71 1..71 356 100 Plus

LD15555.pep Sequence

Translation from 145 to 360

> LD15555.pep
MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS
DELMEQLRKTGKSTTYVGVKK*

LD15555.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-15 21:11:39
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF25160-PA 64 GF25160-PA 21..64 28..71 187 81.8 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 21:11:40
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG16213-PA 71 GG16213-PA 1..71 1..71 349 97.2 Plus
Blast to dgri-all-translation-r1.3.fasta performed 2019-03-15 21:11:40
Subject Length Description Subject Range Query Range Score Percent Strand
Dgri\GH16365-PA 71 GH16365-PA 1..71 1..71 331 88.7 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:26:16
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-PA 71 CG32446-PA 1..71 1..71 356 100 Plus
Atox1-PB 89 CG32446-PB 1..71 1..71 356 100 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-15 21:11:41
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI11557-PA 71 GI11557-PA 1..71 1..71 296 78.9 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-15 21:11:42
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA16911-PA 71 GA16911-PA 1..71 1..71 340 91.5 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 21:11:42
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM22395-PA 71 GM22395-PA 1..71 1..71 358 100 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 21:11:42
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD14984-PA 71 GD14984-PA 1..71 1..71 353 98.6 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-15 21:11:43
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ11130-PA 71 GJ11130-PA 1..71 1..71 329 88.7 Plus
Dvir\GJ11235-PA 71 GJ11235-PA 1..71 1..71 329 88.7 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-15 21:11:43
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK17053-PA 62 GK17053-PA 1..62 10..71 285 88.7 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 21:11:44
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE19782-PA 71 GE19782-PA 1..71 1..71 349 97.2 Plus