BDGP Sequence Production Resources |
Search the DGRC for LD15555
Library: | LD |
Tissue Source: | Drosophila melanogaster embryo |
Created by: | Ling Hong |
Date Registered: | 1997-12-04 |
Comments: | Constructed using Stratagene ZAP-cDNA Synthesis kit. Oligo dT-primed and directionally cloned at EcoRI and XhoI in BlueScript SK(+/-) |
Original Plate Number: | 155 |
Well: | 55 |
Vector: | pBS SK- |
Associated Gene/Transcript | Atox1-RA |
Protein status: | LD15555.pep: gold |
Preliminary Size: | 1086 |
Sequenced Size: | 872 |
Gene | Date | Evidence |
---|---|---|
CG12562 | 2001-01-01 | Release 2 assignment |
CG32446 | 2001-10-10 | Blastp of sequenced clone |
CG32446 | 2003-01-01 | Sim4 clustering to Release 3 |
CG32446 | 2008-04-29 | Release 5.5 accounting |
CG32446 | 2008-08-15 | Release 5.9 accounting |
CG32446 | 2008-12-18 | 5.12 accounting |
872 bp (872 high quality bases) assembled on 2001-10-10
GenBank Submission: AY061200
> LD15555.complete ATTCGCTGAAAAAACGAAGGGAGTTTCTGAGTGCCACGTTTGGAACTGAG AGTAGCCGAGGAAAGCCGTCAAGCTGTTCAACCTACCGCAAGTCTACAAG CAGACGACGGACTCCAGAAGTCACAGCAGCAGCAGCAGCAGCAGGATGAC AGTGCACGAATTCAAGGTGGAGATGACCTGCGGCGGATGTGCCAGTGCCG TGGAGCGAGTCCTGGGCAAACTGGGCGATAAGGTCGAGAAAGTCAACATT AACCTGGAGGATCGGACGGTGAGCGTGACGTCGAACCTGTCGTCCGACGA GTTGATGGAGCAGCTGCGCAAGACCGGCAAGAGCACCACCTACGTCGGGG TGAAGAAATGAGACGAGTTCCTCAGCAAGTTTCAGAAGTACGGCAGGCTG AAACTTGAGGTATAGGGTGTGGACCCCAGAGGATTGAAATATCTTCCACG TTGCCGCTCCGAAAGCATTCGATTTGGGTCGCTGTTCAGTGATATTCATG GGATACATACAAATTTTACTCTTAACCAAATCAAATATAGGAATCATATA CAAATTTTACCTTAGTATTTGCTCTTGCCCAAATTGTATGTAGCTCGTAG TTAACCAATTGAGGTGTTATTATATTATGCATTACTTATGCTTAGATGAA GAATTTTAAATTCAAATTTAACTAATCAAATCGTACAGCCAACTTTTTGC CTAAGTATGCAGGTGCCGTATTTAGGGGTACTCAAGTAAATCCAACGTAG TTGCCAATAAATGATATACGCCAGTTGCCCTCTTATGACTAATCGTAATA TTACAAATTTTACCATTTTAAATATCAAATATATACAAATACATTTTAAC CTTAAAAAAAAAAAAAAAAAAA
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
chr3L | 24539361 | chr3L | 21630909..21631535 | 227..853 | 3135 | 100 | Plus |
chr3L | 24539361 | chr3L | 21629981..21630134 | 1..154 | 770 | 100 | Plus |
chr3L | 24539361 | chr3L | 21630223..21630298 | 152..227 | 380 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
3L | 28110227 | 3L | 21641973..21642602 | 227..856 | 3150 | 100 | Plus |
3L | 28110227 | 3L | 21641045..21641198 | 1..154 | 770 | 100 | Plus |
3L | 28110227 | 3L | 21641287..21641362 | 152..227 | 380 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
3L | 28103327 | 3L | 21635073..21635702 | 227..856 | 3150 | 100 | Plus |
3L | 28103327 | 3L | 21634145..21634298 | 1..154 | 770 | 100 | Plus |
3L | 28103327 | 3L | 21634387..21634462 | 152..227 | 380 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Transpac | 5249 | Transpac 5249bp Derived from AF222049 (AF222049.1) (Rel. 62, Last updated, Version 1). | 4006..4058 | 847..798 | 114 | 71.7 | Minus |
Rt1a | 5108 | Rt1a DME278684 5108bp Derived from AJ278684 (AJ278684.1) (Rel. 64, Last updated, Version 1). | 316..350 | 653..687 | 112 | 80 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
chr3L | 21629981..21630131 | 1..151 | 100 | -> | Plus |
chr3L | 21630223..21630298 | 152..227 | 100 | -> | Plus |
chr3L | 21630910..21631535 | 228..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG32446-RA | 1..216 | 146..361 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RA | 1..216 | 146..361 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RB | 1..270 | 146..415 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG32446-RA | 1..216 | 146..361 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RB | 1..270 | 146..415 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG32446-RA | 4..856 | 1..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RA | 4..856 | 1..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RA | 51..903 | 1..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG32446-RA | 4..856 | 1..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Atox1-RA | 51..903 | 1..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3L | 21641045..21641195 | 1..151 | 100 | -> | Plus |
3L | 21641287..21641362 | 152..227 | 100 | -> | Plus |
3L | 21641974..21642599 | 228..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3L | 21641045..21641195 | 1..151 | 100 | -> | Plus |
3L | 21641287..21641362 | 152..227 | 100 | -> | Plus |
3L | 21641974..21642599 | 228..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3L | 21641045..21641195 | 1..151 | 100 | -> | Plus |
3L | 21641287..21641362 | 152..227 | 100 | -> | Plus |
3L | 21641974..21642599 | 228..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
arm_3L | 21634145..21634295 | 1..151 | 100 | -> | Plus |
arm_3L | 21634387..21634462 | 152..227 | 100 | -> | Plus |
arm_3L | 21635074..21635699 | 228..853 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3L | 21635074..21635699 | 228..853 | 100 | Plus | |
3L | 21634145..21634295 | 1..151 | 100 | -> | Plus |
3L | 21634387..21634462 | 152..227 | 100 | -> | Plus |
Translation from 145 to 360
> LD15555.hyp MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS DELMEQLRKTGKSTTYVGVKK*
Translation from 145 to 360
> LD15555.pep MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS DELMEQLRKTGKSTTYVGVKK*
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dana\GF25160-PA | 64 | GF25160-PA | 21..64 | 28..71 | 187 | 81.8 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dere\GG16213-PA | 71 | GG16213-PA | 1..71 | 1..71 | 349 | 97.2 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dgri\GH16365-PA | 71 | GH16365-PA | 1..71 | 1..71 | 331 | 88.7 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Atox1-PA | 71 | CG32446-PA | 1..71 | 1..71 | 356 | 100 | Plus |
Atox1-PB | 89 | CG32446-PB | 1..71 | 1..71 | 356 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dmoj\GI11557-PA | 71 | GI11557-PA | 1..71 | 1..71 | 296 | 78.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dpse\GA16911-PA | 71 | GA16911-PA | 1..71 | 1..71 | 340 | 91.5 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsec\GM22395-PA | 71 | GM22395-PA | 1..71 | 1..71 | 358 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsim\GD14984-PA | 71 | GD14984-PA | 1..71 | 1..71 | 353 | 98.6 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dvir\GJ11130-PA | 71 | GJ11130-PA | 1..71 | 1..71 | 329 | 88.7 | Plus |
Dvir\GJ11235-PA | 71 | GJ11235-PA | 1..71 | 1..71 | 329 | 88.7 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dwil\GK17053-PA | 62 | GK17053-PA | 1..62 | 10..71 | 285 | 88.7 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dyak\GE19782-PA | 71 | GE19782-PA | 1..71 | 1..71 | 349 | 97.2 | Plus |