Clone LP10528 Report

Search the DGRC for LP10528

Clone and Library Details

Library:LP
Tissue Source:Drosophila melanogaster larval-early pupal
Created by:Ling Hong
Date Registered:1998-06-11
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:105
Well:28
Vector:pOT2
Associated Gene/TranscriptCG9040-RA
Protein status:LP10528.pep: gold
Preliminary Size:677
Sequenced Size:767

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG9040 2002-01-01 Sim4 clustering to Release 2
CG9040 2002-06-13 Blastp of sequenced clone
CG9040 2003-01-01 Sim4 clustering to Release 3
CG9040 2008-04-29 Release 5.5 accounting
CG9040 2008-08-15 Release 5.9 accounting
CG9040 2008-12-18 5.12 accounting

Clone Sequence Records

LP10528.complete Sequence

767 bp (767 high quality bases) assembled on 2002-06-13

GenBank Submission: AY122218

> LP10528.complete
TTACCTATCTGTTCGTTGACTCTATAGATACAAAAAAAAAAAAGATGAGG
CTGCTGTTGGTTTTAAGCCTGGCCATATTGGTTGCCTTCGTAACGGGTGC
TGATGACACTGACGATGACTATTACGATTATTACGACTATGGTGATGACT
ACTATGACGACTCTGATGTAGAGTCCAGTTCGGAAAGTGGTGTTGGTGCA
TCCAGTAGCTCAGAAGATGATGCTAGTACCTCCGAGGACAGTTCCTCCGG
CGAAGCTTCCGATACAGGTAGTTCTTCAGAAACTTCTGGAGATGGTTCCT
CCGCCGAAACGACCTCCAGTTCAACTCCAACCAAGGCAGAAAAAGCCAAG
AAAACTGCTGCACGCAGAGCTAGACGGCGCAGGCGCACCACCACCGCTGC
TCCCAAACGCAAAGTAGCGGCAGCCGCGTCTGCCAAGAAGCAAACACCTG
TTGCCCAAAAGAAGAAGACACCTGTGGCAGCCAAGAAGAAGGCGAATACT
GCCGCCAACAAACGCAAACGCACAGGCTAAGCAGTTCGAAAAAAGGATAA
ATTCCCCATAGTCACTGAAAGTTTTTACATCAAACTTTTAAGAGGACCAA
GAGACATCTTGTAGAATCTACATTAGTCTGGGAATATTTCATATGTTGTT
TTCTGTACAAAAAATCCATATAAAAATACAAAGATAAGGAGACGTTTTGT
AATTTACCAAAAATATACATTATTAATCCAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA

LP10528.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 18:12:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG9040-RA 728 CG9040-RA 1..728 1..729 3605 99.8 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 02:55:46
Subject Length Description Subject Range Query Range Score Percent Strand
chr3L 24539361 chr3L 13977979..13978707 1..729 3585 99.5 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 19:54:32 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 02:55:44
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 13987899..13988630 1..733 3615 99.9 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:55:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28103327 3L 13980999..13981730 1..733 3625 99.8 Plus
Blast to na_te.dros performed on 2019-03-16 02:55:45 has no hits.

LP10528.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 02:56:20 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
chr3L 13977979..13978707 1..729 99   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 19:40:39 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..486 45..530 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 16:44:19 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..486 45..530 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 06:41:06 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..486 45..530 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 17:34:47 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..486 45..530 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 05:25:39 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..486 45..530 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 19:54:52 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..728 1..729 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 16:44:19 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 22..749 1..729 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 06:41:06 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 22..749 1..729 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 17:34:48 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 1..728 1..729 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 05:25:39 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
CG9040-RA 22..749 1..729 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 02:56:20 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
3L 13987899..13988626 1..729 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 02:56:20 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
3L 13987899..13988626 1..729 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 02:56:20 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
3L 13987899..13988626 1..729 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:41:06 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 13980999..13981726 1..729 99   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 14:05:47 Download gff for LP10528.complete
Subject Subject Range Query Range Percent Splice Strand
3L 13980999..13981726 1..729 99   Plus

LP10528.pep Sequence

Translation from 44 to 529

> LP10528.pep
MRLLLVLSLAILVAFVTGADDTDDDYYDYYDYGDDYYDDSDVESSSESGV
GASSSSEDDASTSEDSSSGEASDTGSSSETSGDGSSAETTSSSTPTKAEK
AKKTAARRARRRRRTTTAAPKRKVAAAASAKKQTPVAQKKKTPVAAKKKA
NTAANKRKRTG*

LP10528.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:26:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG9040-PA 161 CG9040-PA 1..161 1..161 790 100 Plus
CG17362-PB 153 CG17362-PB 1..153 1..161 253 42.9 Plus
CG14265-PB 119 CG14265-PB 26..108 40..127 136 39.8 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-15 19:01:32
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL15721-PA 174 GL15721-PA 1..171 1..159 158 41.8 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-15 19:01:33
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA23774-PA 174 GA23774-PA 1..171 1..159 163 41.9 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 19:01:34
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM25441-PA 152 GM25441-PA 1..150 1..148 283 65.1 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 19:01:34
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD14468-PA 169 GD14468-PA 1..152 1..144 155 68.6 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 19:01:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE21991-PA 159 GE21991-PA 1..159 1..161 196 61.6 Plus

LP10528.hyp Sequence

Translation from 44 to 529

> LP10528.hyp
MRLLLVLSLAILVAFVTGADDTDDDYYDYYDYGDDYYDDSDVESSSESGV
GASSSSEDDASTSEDSSSGEASDTGSSSETSGDGSSAETTSSSTPTKAEK
AKKTAARRARRRRRTTTAAPKRKVAAAASAKKQTPVAQKKKTPVAAKKKA
NTAANKRKRTG*

LP10528.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:52:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG9040-PA 161 CG9040-PA 1..161 1..161 790 100 Plus
CG17362-PB 153 CG17362-PB 1..153 1..161 253 42.9 Plus
CG14265-PB 119 CG14265-PB 26..108 40..127 136 39.8 Plus