Clone MIP07450 Report

Search the DGRC for MIP07450

Clone and Library Details

Library:MIP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by:
Date Registered:2008-10-08
Comments:
Original Plate Number:74
Well:50
Vector:pOT2|pOTB7_DraIII
Associated Gene/TranscriptSfp60F-RB
Protein status:MIP07450.pep: gold
Sequenced Size:322

Clone Sequence Records

MIP07450.complete Sequence

322 bp assembled on 2009-03-19

GenBank Submission: BT072953.1

> MIP07450.complete
CAGAAGCTTTGCTACCAAATTCTGCGCAATGTCTCGCCTTTTTATTTTAG
CACTTATTCTGTCCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAG
CTTTTACGAAGCATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCC
TAGTCTTGCAAGGTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTT
CGATTGGATATGGTGGCTGAGTTATCCGATTTTTGATAAAGATCATCCTG
AAAAATCTTTTCGTTTATAAAAGAAAACTTTTAATAAAATTTTAATTTTA
AAAAAAAAAAAAAAAAAAAAAA

MIP07450.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 21:27:45
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-RA 440 Sfp60F-RA 62..363 1..302 1510 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 18:48:02
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 21058225..21058480 299..44 1265 99.6 Minus
chr2R 21145070 chr2R 21058534..21058576 43..1 200 97.7 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:08:55 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 18:48:00
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25172313..25172571 302..44 1295 100 Minus
2R 25286936 2R 25172624..25172666 43..1 215 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:44:31
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 25173512..25173770 302..44 1295 100 Minus
2R 25260384 2R 25173823..25173865 43..1 215 100 Minus
Blast to na_te.dros performed 2019-03-15 18:48:00
Subject Length Description Subject Range Query Range Score Percent Strand
invader3 5484 invader3 INVADER3 5484bp 1846..1897 250..298 118 73.1 Plus

MIP07450.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 18:49:06 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 21058263..21058480 44..261 99 <- Minus
chr2R 21058534..21058576 1..43 97   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 18:07:35 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..249 1..220 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:41:35 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..249 1..220 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 02:31:49 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..249 1..220 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:01:16 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..249 1..220 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-03-19 17:31:01 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..328 1..299 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:41:35 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..328 1..299 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 02:31:49 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..328 1..299 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:01:16 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 30..328 1..299 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25172316..25172571 44..299 100 <- Minus
2R 25172624..25172666 1..43 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25172316..25172571 44..299 100 <- Minus
2R 25172624..25172666 1..43 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25172316..25172571 44..299 100 <- Minus
2R 25172624..25172666 1..43 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 02:31:49 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21060147..21060189 1..43 100   Minus
arm_2R 21059839..21060094 44..299 100 <- Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:16:09 Download gff for MIP07450.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25173533..25173788 44..299 100 <- Minus
2R 25173841..25173883 1..43 100   Minus

MIP07450.hyp Sequence

Translation from 0 to 219

> MIP07450.hyp
RSFATKFCAMSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINP
SLARSGFGIRTPSSEFSIGYGG*

MIP07450.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:15:13
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-PA 82 CG42478-PA 11..82 1..72 354 100 Plus
Sfp60F-PB 63 CG42478-PB 1..63 10..72 306 100 Plus

MIP07450.pep Sequence

Translation from 1 to 219

> MIP07450.pep
RSFATKFCAMSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINP
SLARSGFGIRTPSSEFSIGYGG*

MIP07450.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:15:28
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-PA 82 CG42478-PA 11..82 1..72 354 100 Plus
Sfp60F-PB 63 CG42478-PB 1..63 10..72 306 100 Plus