MIP07450.complete Sequence
322 bp assembled on 2009-03-19
GenBank Submission: BT072953.1
> MIP07450.complete
CAGAAGCTTTGCTACCAAATTCTGCGCAATGTCTCGCCTTTTTATTTTAG
CACTTATTCTGTCCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAG
CTTTTACGAAGCATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCC
TAGTCTTGCAAGGTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTT
CGATTGGATATGGTGGCTGAGTTATCCGATTTTTGATAAAGATCATCCTG
AAAAATCTTTTCGTTTATAAAAGAAAACTTTTAATAAAATTTTAATTTTA
AAAAAAAAAAAAAAAAAAAAAA
MIP07450.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 21:27:45
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-RA | 440 | Sfp60F-RA | 62..363 | 1..302 | 1510 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-15 18:48:02
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2R | 21145070 | chr2R | 21058225..21058480 | 299..44 | 1265 | 99.6 | Minus |
chr2R | 21145070 | chr2R | 21058534..21058576 | 43..1 | 200 | 97.7 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:08:55 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 18:48:00
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 25172313..25172571 | 302..44 | 1295 | 100 | Minus |
2R | 25286936 | 2R | 25172624..25172666 | 43..1 | 215 | 100 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:44:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25260384 | 2R | 25173512..25173770 | 302..44 | 1295 | 100 | Minus |
2R | 25260384 | 2R | 25173823..25173865 | 43..1 | 215 | 100 | Minus |
Blast to na_te.dros performed 2019-03-15 18:48:00
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
invader3 | 5484 | invader3 INVADER3 5484bp | 1846..1897 | 250..298 | 118 | 73.1 | Plus |
MIP07450.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 18:49:06 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2R | 21058263..21058480 | 44..261 | 99 | <- | Minus |
chr2R | 21058534..21058576 | 1..43 | 97 | | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 18:07:35 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..249 | 1..220 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:41:35 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..249 | 1..220 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 02:31:49 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..249 | 1..220 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:01:16 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..249 | 1..220 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-03-19 17:31:01 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..328 | 1..299 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:41:35 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..328 | 1..299 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 02:31:49 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..328 | 1..299 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:01:16 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 30..328 | 1..299 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25172316..25172571 | 44..299 | 100 | <- | Minus |
2R | 25172624..25172666 | 1..43 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25172316..25172571 | 44..299 | 100 | <- | Minus |
2R | 25172624..25172666 | 1..43 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 18:49:06 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25172316..25172571 | 44..299 | 100 | <- | Minus |
2R | 25172624..25172666 | 1..43 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 02:31:49 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 21060147..21060189 | 1..43 | 100 | | Minus |
arm_2R | 21059839..21060094 | 44..299 | 100 | <- | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:16:09 Download gff for
MIP07450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25173533..25173788 | 44..299 | 100 | <- | Minus |
2R | 25173841..25173883 | 1..43 | 100 | | Minus |
MIP07450.hyp Sequence
Translation from 0 to 219
> MIP07450.hyp
RSFATKFCAMSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINP
SLARSGFGIRTPSSEFSIGYGG*
MIP07450.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:15:13
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-PA | 82 | CG42478-PA | 11..82 | 1..72 | 354 | 100 | Plus |
Sfp60F-PB | 63 | CG42478-PB | 1..63 | 10..72 | 306 | 100 | Plus |
MIP07450.pep Sequence
Translation from 1 to 219
> MIP07450.pep
RSFATKFCAMSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINP
SLARSGFGIRTPSSEFSIGYGG*
MIP07450.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:15:28
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-PA | 82 | CG42478-PA | 11..82 | 1..72 | 354 | 100 | Plus |
Sfp60F-PB | 63 | CG42478-PB | 1..63 | 10..72 | 306 | 100 | Plus |