MIP13748.complete Sequence
395 bp assembled on 2009-10-05
GenBank Submission: BT099956.1
> MIP13748.complete
ACGTCCGCCACTGAACGCAAGATGACGCTCCACAAGCTGCCCGCCAAGTG
CATTCTGCTCGTGGTGTTGCTGCTCCTGCTGGACTCCAGCCTGGCCAGGT
CGCAACAGTTCTTCGTCGCCGAGGATGTGATAACAGGAACGGCAACTGAA
ACGGGAACTGCAGCTGCAAGCAGAACCGTATTTGGTGATGATCAATTGCC
CATCAACGATCCATCGGATCTAAGTGCTGGTTTAAATTTGGCGCCCGTTG
GCAGTCTGATTGCGGCAGCAGCGAATGCCGTACCCCCTGCCCCTGTTCAA
TTTATTCGCACGGCCATGAACAGCGGGCTCTGACCGCCAGGTGGCGCTAA
CCTGAATTCCAAAATAACCCAAAAAAAAAAAAAAAAAAAAAAAAA
MIP13748.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 16:53:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG14406-RA | 827 | CG14406-RA | 88..462 | 1..375 | 1875 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-15 14:58:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chrX | 22417052 | chrX | 14800838..14801054 | 217..1 | 1055 | 99.1 | Minus |
chrX | 22417052 | chrX | 14800379..14800532 | 370..217 | 770 | 100 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:15:08 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 14:58:39
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
X | 23542271 | X | 14910624..14910840 | 217..1 | 1085 | 100 | Minus |
X | 23542271 | X | 14910160..14910318 | 375..217 | 795 | 100 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:49:45
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
X | 23527363 | X | 14918722..14918938 | 217..1 | 1085 | 100 | Minus |
X | 23527363 | X | 14918258..14918416 | 375..217 | 795 | 100 | Minus |
Blast to na_te.dros performed on 2019-03-15 14:58:39 has no hits.
MIP13748.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 14:59:40 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chrX | 14800379..14800531 | 218..370 | 100 | <- | Minus |
chrX | 14800838..14801054 | 1..217 | 99 | | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 17:56:46 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 1..312 | 22..333 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:41:04 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 1..312 | 22..333 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 00:55:50 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 1..312 | 22..333 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:20:25 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 1..312 | 22..333 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 11:36:28 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 6..375 | 1..370 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:41:04 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 6..375 | 1..370 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 00:55:50 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 6..375 | 1..370 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:20:25 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14406-RA | 6..375 | 1..370 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 14910165..14910317 | 218..370 | 100 | <- | Minus |
X | 14910624..14910840 | 1..217 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 14910165..14910317 | 218..370 | 100 | <- | Minus |
X | 14910624..14910840 | 1..217 | 100 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 14910165..14910317 | 218..370 | 100 | <- | Minus |
X | 14910624..14910840 | 1..217 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 00:55:50 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_X | 14804198..14804350 | 218..370 | 100 | <- | Minus |
arm_X | 14804657..14804873 | 1..217 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:22:48 Download gff for
MIP13748.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 14918722..14918938 | 1..217 | 100 | | Minus |
X | 14918263..14918415 | 218..370 | 100 | <- | Minus |
MIP13748.hyp Sequence
Translation from 0 to 332
> MIP13748.hyp
TSATERKMTLHKLPAKCILLVVLLLLLDSSLARSQQFFVAEDVITGTATE
TGTAAASRTVFGDDQLPINDPSDLSAGLNLAPVGSLIAAAANAVPPAPVQ
FIRTAMNSGL*
MIP13748.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:02:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG14406-PB | 103 | CG14406-PB | 1..103 | 8..110 | 503 | 100 | Plus |
CG14406-PA | 103 | CG14406-PA | 1..103 | 8..110 | 503 | 100 | Plus |
MIP13748.pep Sequence
Translation from 0 to 332
> MIP13748.pep
TSATERKMTLHKLPAKCILLVVLLLLLDSSLARSQQFFVAEDVITGTATE
TGTAAASRTVFGDDQLPINDPSDLSAGLNLAPVGSLIAAAANAVPPAPVQ
FIRTAMNSGL*
MIP13748.pep Blast Records
Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 14:25:29
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dana\GF19425-PA | 109 | GF19425-PA | 8..109 | 12..110 | 158 | 59.2 | Plus |
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 14:25:29
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG19432-PA | 103 | GG19432-PA | 1..103 | 8..110 | 274 | 70.9 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:55:36
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG14406-PB | 103 | CG14406-PB | 1..103 | 8..110 | 503 | 100 | Plus |
CG14406-PA | 103 | CG14406-PA | 1..103 | 8..110 | 503 | 100 | Plus |
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-16 14:25:30
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dmoj\GI15374-PA | 106 | GI15374-PA | 64..106 | 68..110 | 169 | 79.1 | Plus |
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 14:25:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dper\GL27082-PA | 83 | GL27082-PA | 3..83 | 20..110 | 191 | 63.7 | Plus |
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 14:25:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dpse\GA12958-PA | 89 | GA12958-PA | 9..89 | 20..110 | 214 | 63.7 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 14:25:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM12019-PA | 103 | GM12019-PA | 1..103 | 8..110 | 346 | 93.2 | Plus |
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 14:25:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsim\GD24503-PA | 103 | GD24503-PA | 1..103 | 8..110 | 346 | 93.2 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 14:25:33
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE16085-PA | 106 | GE16085-PA | 1..106 | 8..110 | 222 | 77.4 | Plus |