Clone MIP13748 Report

Search the DGRC for MIP13748

Clone and Library Details

Library:MIP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by:
Date Registered:2008-10-08
Comments:
Original Plate Number:137
Well:48
Vector:pOT2|pOTB7_DraIII
Associated Gene/TranscriptCG14406-RA
Protein status:MIP13748.pep: gold
Sequenced Size:395

Clone Sequence Records

MIP13748.complete Sequence

395 bp assembled on 2009-10-05

GenBank Submission: BT099956.1

> MIP13748.complete
ACGTCCGCCACTGAACGCAAGATGACGCTCCACAAGCTGCCCGCCAAGTG
CATTCTGCTCGTGGTGTTGCTGCTCCTGCTGGACTCCAGCCTGGCCAGGT
CGCAACAGTTCTTCGTCGCCGAGGATGTGATAACAGGAACGGCAACTGAA
ACGGGAACTGCAGCTGCAAGCAGAACCGTATTTGGTGATGATCAATTGCC
CATCAACGATCCATCGGATCTAAGTGCTGGTTTAAATTTGGCGCCCGTTG
GCAGTCTGATTGCGGCAGCAGCGAATGCCGTACCCCCTGCCCCTGTTCAA
TTTATTCGCACGGCCATGAACAGCGGGCTCTGACCGCCAGGTGGCGCTAA
CCTGAATTCCAAAATAACCCAAAAAAAAAAAAAAAAAAAAAAAAA

MIP13748.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 16:53:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG14406-RA 827 CG14406-RA 88..462 1..375 1875 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 14:58:40
Subject Length Description Subject Range Query Range Score Percent Strand
chrX 22417052 chrX 14800838..14801054 217..1 1055 99.1 Minus
chrX 22417052 chrX 14800379..14800532 370..217 770 100 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:15:08 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 14:58:39
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 14910624..14910840 217..1 1085 100 Minus
X 23542271 X 14910160..14910318 375..217 795 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:49:45
Subject Length Description Subject Range Query Range Score Percent Strand
X 23527363 X 14918722..14918938 217..1 1085 100 Minus
X 23527363 X 14918258..14918416 375..217 795 100 Minus
Blast to na_te.dros performed on 2019-03-15 14:58:39 has no hits.

MIP13748.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 14:59:40 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
chrX 14800379..14800531 218..370 100 <- Minus
chrX 14800838..14801054 1..217 99   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 17:56:46 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 1..312 22..333 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:41:04 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 1..312 22..333 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 00:55:50 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 1..312 22..333 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:20:25 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 1..312 22..333 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 11:36:28 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 6..375 1..370 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:41:04 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 6..375 1..370 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 00:55:50 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 6..375 1..370 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:20:25 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
CG14406-RA 6..375 1..370 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
X 14910165..14910317 218..370 100 <- Minus
X 14910624..14910840 1..217 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
X 14910165..14910317 218..370 100 <- Minus
X 14910624..14910840 1..217 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 14:59:40 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
X 14910165..14910317 218..370 100 <- Minus
X 14910624..14910840 1..217 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 00:55:50 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
arm_X 14804198..14804350 218..370 100 <- Minus
arm_X 14804657..14804873 1..217 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:22:48 Download gff for MIP13748.complete
Subject Subject Range Query Range Percent Splice Strand
X 14918722..14918938 1..217 100   Minus
X 14918263..14918415 218..370 100 <- Minus

MIP13748.hyp Sequence

Translation from 0 to 332

> MIP13748.hyp
TSATERKMTLHKLPAKCILLVVLLLLLDSSLARSQQFFVAEDVITGTATE
TGTAAASRTVFGDDQLPINDPSDLSAGLNLAPVGSLIAAAANAVPPAPVQ
FIRTAMNSGL*

MIP13748.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:02:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG14406-PB 103 CG14406-PB 1..103 8..110 503 100 Plus
CG14406-PA 103 CG14406-PA 1..103 8..110 503 100 Plus

MIP13748.pep Sequence

Translation from 0 to 332

> MIP13748.pep
TSATERKMTLHKLPAKCILLVVLLLLLDSSLARSQQFFVAEDVITGTATE
TGTAAASRTVFGDDQLPINDPSDLSAGLNLAPVGSLIAAAANAVPPAPVQ
FIRTAMNSGL*

MIP13748.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 14:25:29
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF19425-PA 109 GF19425-PA 8..109 12..110 158 59.2 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 14:25:29
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG19432-PA 103 GG19432-PA 1..103 8..110 274 70.9 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:55:36
Subject Length Description Subject Range Query Range Score Percent Strand
CG14406-PB 103 CG14406-PB 1..103 8..110 503 100 Plus
CG14406-PA 103 CG14406-PA 1..103 8..110 503 100 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-16 14:25:30
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI15374-PA 106 GI15374-PA 64..106 68..110 169 79.1 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 14:25:31
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL27082-PA 83 GL27082-PA 3..83 20..110 191 63.7 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 14:25:31
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA12958-PA 89 GA12958-PA 9..89 20..110 214 63.7 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 14:25:32
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM12019-PA 103 GM12019-PA 1..103 8..110 346 93.2 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 14:25:32
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD24503-PA 103 GD24503-PA 1..103 8..110 346 93.2 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 14:25:33
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE16085-PA 106 GE16085-PA 1..106 8..110 222 77.4 Plus