Clone MIP24548 Report

Search the DGRC for MIP24548

Clone and Library Details

Library:MIP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by:
Date Registered:2008-10-08
Comments:
Original Plate Number:245
Well:48
Vector:pOT2
Associated Gene/TranscriptCG13438-RA
Protein status:MIP24548.pep: gold
Sequenced Size:832

Clone Sequence Records

MIP24548.complete Sequence

832 bp assembled on 2010-08-11

GenBank Submission: BT125101.1

> MIP24548.complete
AAAGATCGTCGAAAAGATGAAGTCGTTCGGGAACTTGACCTTTGGCCTAC
TCGTCATCCTTATAGCAAGCTTTACTGTCGGCCTAGAGGCTCGTCGCCTG
GCTTTGCGTCCATTGACAGGAAGGGAACTGAGAAGAGCTCTTAGGGAATC
CGGATTCGATGAGGATTCTGCAGCTGGAAGATCAGTGGCGTCGGCGCTGT
CCGGACTCAGTGGATTCGCCCTGGGCATCACAAAGGGCATTGGTGGCTCA
CTGCTGTTCGATGTGGTCACCTCGAATGTGACCATTGATTACATTACCAG
TCTGCTGAACTCCACTGCCTCATCGTCGACTTCAAGCAGCAGTGGAACTG
CACAGGAGATCTGTTTCAACAGTCGCAGTGCCGACGGTGAGGTGATTAAC
GGCAGGAGTAATGGCTTCAATGACATGGATGATGGAGCAGATCTCGACGG
CGAGTGGAGACAGACTACCAGTGGCACGGGCACGGGCTCTGTTACTGGCA
CTGGCACTGAGACAGGAACTACCACCTCCTCGTCTTCCAACGGCCTCACC
TGCATTGTCCTGAGCAAGGAGGGTTCCCGTCGCAGGCGCCAGTTGCGAAT
CCAACCAGGAACGTTGAGATCTGTTTATCCTAAAAGCCATCGGCAGACCC
TGAAAAAGTACCGCCGGCATAGGGTTTAGGTTTTAGCCCAGCTCCTTACT
TTAAGCTAACTTATTTATTGACTTCGATTAGTTTATTAAATTTTAATTGT
TCCGCATTCCATGGGCCTGCCATGGGTGGGCTGCCTTCATTAATGGCCGA
ATGACTTGGAAAAAAAAAAAAAAAAAAAAAAA

MIP24548.complete Blast Records

Blast to d_melanogaster_OreR.fa performed 2019-03-16 15:49:31
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 16579690..16580410 89..809 3605 100 Plus
chr2R 21145070 chr2R 16579525..16579613 1..89 445 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 15:49:30
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20693019..20693744 89..814 3615 99.9 Plus
2R 25286936 2R 20692854..20692942 1..89 445 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:49:52
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 20694218..20694943 89..814 3615 99.8 Plus
2R 25260384 2R 20694053..20694141 1..89 445 100 Plus
Blast to na_te.dros performed on 2019-03-16 15:49:30 has no hits.

MIP24548.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 15:50:27 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 16579525..16579613 1..89 100 -> Plus
chr2R 16579691..16580410 90..809 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2010-08-11 16:59:23 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:50:25 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 16:19:34 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 11:49:04 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-11 16:59:22 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:50:25 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 1..663 17..679 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 16:19:34 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 26..834 1..809 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 11:49:04 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
CG13438-RA 26..834 1..809 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 15:50:27 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
2R 20692854..20692942 1..89 100 -> Plus
2R 20693020..20693739 90..809 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 15:50:27 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
2R 20692854..20692942 1..89 100 -> Plus
2R 20693020..20693739 90..809 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 15:50:27 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
2R 20692854..20692942 1..89 100 -> Plus
2R 20693020..20693739 90..809 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 16:19:34 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16580359..16580447 1..89 100 -> Plus
arm_2R 16580525..16581244 90..809 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:26:18 Download gff for MIP24548.complete
Subject Subject Range Query Range Percent Splice Strand
2R 20694219..20694938 90..809 100   Plus
2R 20694053..20694141 1..89 100 -> Plus

MIP24548.hyp Sequence

Translation from 0 to 678

> MIP24548.hyp
KIVEKMKSFGNLTFGLLVILIASFTVGLEARRLALRPLTGRELRRALRES
GFDEDSAAGRSVASALSGLSGFALGITKGIGGSLLFDVVTSNVTIDYITS
LLNSTASSSTSSSSGTAQEICFNSRSADGEVINGRSNGFNDMDDGADLDG
EWRQTTSGTGTGSVTGTGTETGTTTSSSSNGLTCIVLSKEGSRRRRQLRI
QPGTLRSVYPKSHRQTLKKYRRHRV*

MIP24548.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-26 14:49:06
Subject Length Description Subject Range Query Range Score Percent Strand
CG13438-PA 220 CG13438-PA 1..220 6..225 1096 100 Plus

MIP24548.pep Sequence

Translation from 1 to 678

> MIP24548.pep
KIVEKMKSFGNLTFGLLVILIASFTVGLEARRLALRPLTGRELRRALRES
GFDEDSAAGRSVASALSGLSGFALGITKGIGGSLLFDVVTSNVTIDYITS
LLNSTASSSTSSSSGTAQEICFNSRSADGEVINGRSNGFNDMDDGADLDG
EWRQTTSGTGTGSVTGTGTETGTTTSSSSNGLTCIVLSKEGSRRRRQLRI
QPGTLRSVYPKSHRQTLKKYRRHRV*

MIP24548.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 21:05:48
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF12196-PA 228 GF12196-PA 4..221 14..224 479 58.2 Plus
Dana\GF12195-PA 310 GF12195-PA 124..274 1..150 355 63.8 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 21:05:48
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG22055-PA 236 GG22055-PA 1..236 6..225 764 74.6 Plus
Dere\GG22054-PA 124 GG22054-PA 27..113 30..131 161 35.3 Plus
Blast to dgri-all-translation-r1.3.fasta performed 2019-03-16 21:05:49
Subject Length Description Subject Range Query Range Score Percent Strand
Dgri\GH21995-PA 225 GH21995-PA 1..135 6..137 228 39 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:27:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG13438-PA 220 CG13438-PA 1..220 6..225 1096 100 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-16 21:05:50
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI19696-PA 234 GI19696-PA 5..206 11..202 261 37.9 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 21:05:50
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL17045-PA 81 GL17045-PA 1..74 6..79 233 64.9 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 21:05:51
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA12288-PA 351 GA12288-PA 131..291 1..154 438 63 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 21:05:52
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM22038-PA 227 GM22038-PA 1..227 6..225 869 85.9 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 21:05:52
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD11535-PA 226 GD11535-PA 1..226 6..225 886 88.1 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-16 21:05:53
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ17332-PA 309 GJ17332-PA 114..279 30..189 222 39.2 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-16 21:05:53
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK23314-PA 233 GK23314-PA 1..132 6..138 372 63.9 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 21:05:54
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE12136-PA 224 GE12136-PA 1..223 6..224 740 84.1 Plus
Dyak\GE12135-PA 121 GE12135-PA 27..110 30..131 161 37.3 Plus