Clone MIP29407 Report

Search the DGRC for MIP29407

Clone and Library Details

Library:MIP
Tissue Source:Pooled D melanogaster cDNA libraries
Created by:
Date Registered:2008-10-08
Comments:
Original Plate Number:294
Well:7
Vector:pOT2|pOTB7_DraIII
Associated Gene/TranscriptCG43069-RA
Protein status:MIP29407.pep: gold
Sequenced Size:457

Clone Sequence Records

MIP29407.complete Sequence

457 bp assembled on 2011-03-01

GenBank Submission: BT126245.1

> MIP29407.complete
TAATTCTAATGTAAAATAGAATGGCCAATCAAAGCAAAACCATTTGGCTT
CTATCCTCAAATCTACCTAAACTGCGGTGCCATGTGAGAACGGATCAACC
TTTGGCCGCACTTCTTAGGCAAAAATATGCCCAGGCATTTGGAGTTGCTA
CTGAGTCTCTGATCCTGGCCTTCGATGGTGAGAAAATCCAGGAGGAGGAC
ACATTTGACTCCTTGGCCATGGAGGATAATGACATCGTCGATGTTGTAGA
AGAATGTTAGTGCTCGAAGACCATGAAGCCAAGTTAATAGAGGCAGTGAA
CTGCGAGAGGTTAGCAGGCGACATTGTACACTGAAAATATTAGATAAAAA
TTGTAAAATAGAAACCCATCGCAAATATATGCATAGACTTGGTAATATTT
TGTCTAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA

MIP29407.complete Blast Records

Blast to d_melanogaster_OreR.fa performed 2019-03-16 22:15:26
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 14750003..14750414 1..412 2060 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 22:15:24
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18862866..18863278 1..413 2065 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 23:06:13
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 18864065..18864477 1..413 2065 100 Plus
Blast to na_te.dros performed on 2019-03-16 22:15:24 has no hits.

MIP29407.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 22:16:08 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 14750003..14750414 1..412 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-01 14:50:13 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 1..240 21..260 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-03 20:53:06 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 1..240 21..260 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 17:25:35 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 1..240 21..260 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-01 14:50:13 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 5..399 1..395 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 20:53:06 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 5..416 1..412 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:25:35 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 5..416 1..412 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18862866..18863277 1..412 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18862866..18863277 1..412 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18862866..18863277 1..412 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 20:53:06 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14750371..14750782 1..412 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:56:53 Download gff for MIP29407.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18864065..18864476 1..412 100   Plus

MIP29407.pep Sequence

Translation from 20 to 259

> MIP29407.pep
MANQSKTIWLLSSNLPKLRCHVRTDQPLAALLRQKYAQAFGVATESLILA
FDGEKIQEEDTFDSLAMEDNDIVDVVEEC*

MIP29407.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 17:58:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF11123-PA 89 GF11123-PA 7..79 3..75 140 38.4 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 17:58:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG21933-PA 87 GG21933-PA 1..81 1..79 318 77.8 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:25:24
Subject Length Description Subject Range Query Range Score Percent Strand
CG43069-PA 79 CG43069-PA 1..79 1..79 401 100 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 17:58:16
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE12006-PA 87 GE12006-PA 1..77 1..77 305 75.3 Plus

MIP29407.hyp Sequence

Translation from 20 to 259

> MIP29407.hyp
MANQSKTIWLLSSNLPKLRCHVRTDQPLAALLRQKYAQAFGVATESLILA
FDGEKIQEEDTFDSLAMEDNDIVDVVEEC*

MIP29407.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:01:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG43069-PA 79 CG43069-PA 1..79 1..79 401 100 Plus