MIP29407.complete Sequence
457 bp assembled on 2011-03-01
GenBank Submission: BT126245.1
> MIP29407.complete
TAATTCTAATGTAAAATAGAATGGCCAATCAAAGCAAAACCATTTGGCTT
CTATCCTCAAATCTACCTAAACTGCGGTGCCATGTGAGAACGGATCAACC
TTTGGCCGCACTTCTTAGGCAAAAATATGCCCAGGCATTTGGAGTTGCTA
CTGAGTCTCTGATCCTGGCCTTCGATGGTGAGAAAATCCAGGAGGAGGAC
ACATTTGACTCCTTGGCCATGGAGGATAATGACATCGTCGATGTTGTAGA
AGAATGTTAGTGCTCGAAGACCATGAAGCCAAGTTAATAGAGGCAGTGAA
CTGCGAGAGGTTAGCAGGCGACATTGTACACTGAAAATATTAGATAAAAA
TTGTAAAATAGAAACCCATCGCAAATATATGCATAGACTTGGTAATATTT
TGTCTAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA
MIP29407.complete Blast Records
Blast to d_melanogaster_OreR.fa performed 2019-03-16 22:15:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2R | 21145070 | chr2R | 14750003..14750414 | 1..412 | 2060 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 22:15:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 18862866..18863278 | 1..413 | 2065 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 23:06:13
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25260384 | 2R | 18864065..18864477 | 1..413 | 2065 | 100 | Plus |
Blast to na_te.dros performed on 2019-03-16 22:15:24 has no hits.
MIP29407.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 22:16:08 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2R | 14750003..14750414 | 1..412 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-01 14:50:13 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 1..240 | 21..260 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-03 20:53:06 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 1..240 | 21..260 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 17:25:35 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 1..240 | 21..260 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-01 14:50:13 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 5..399 | 1..395 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 20:53:06 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 5..416 | 1..412 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:25:35 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43069-RA | 5..416 | 1..412 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18862866..18863277 | 1..412 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18862866..18863277 | 1..412 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 22:16:08 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18862866..18863277 | 1..412 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 20:53:06 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 14750371..14750782 | 1..412 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:56:53 Download gff for
MIP29407.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18864065..18864476 | 1..412 | 100 | | Plus |
MIP29407.pep Sequence
Translation from 20 to 259
> MIP29407.pep
MANQSKTIWLLSSNLPKLRCHVRTDQPLAALLRQKYAQAFGVATESLILA
FDGEKIQEEDTFDSLAMEDNDIVDVVEEC*
MIP29407.pep Blast Records
Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 17:58:12
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dana\GF11123-PA | 89 | GF11123-PA | 7..79 | 3..75 | 140 | 38.4 | Plus |
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 17:58:12
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG21933-PA | 87 | GG21933-PA | 1..81 | 1..79 | 318 | 77.8 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:25:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG43069-PA | 79 | CG43069-PA | 1..79 | 1..79 | 401 | 100 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 17:58:16
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE12006-PA | 87 | GE12006-PA | 1..77 | 1..77 | 305 | 75.3 | Plus |
MIP29407.hyp Sequence
Translation from 20 to 259
> MIP29407.hyp
MANQSKTIWLLSSNLPKLRCHVRTDQPLAALLRQKYAQAFGVATESLILA
FDGEKIQEEDTFDSLAMEDNDIVDVVEEC*
MIP29407.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:01:23
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG43069-PA | 79 | CG43069-PA | 1..79 | 1..79 | 401 | 100 | Plus |