Clone MXO01001 Report

Search the DGRC for MXO01001

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:10
Well:1
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptRpb10-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO01001.5prime Sequence

225 bp (225 high quality bases) assembled on 2006-12-21

> MXO01001.5prime
CAGTCGACATGATTATTCCAATCCGTTGTTTCACCTGCGGCAAGGTCATT
GGCAACAAGTGGGAGTCGTATTTGGGTCTCCTGCAAGCGGAATACACCGA
AGGAGATGCCCTGGATGCTTTGGGTCTAAAGAGGTACTGCTGCCGTCGCA
TGCTCCTGGGCCACGTGGATCTTATCGAAAAACTGCTCAACTATGCTCCT
CTGGAGAAGGCAAGCTTTCTAGACC

MXO01001.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-07 22:19:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG13628-PA 204 Rpb10-RA 1..201 9..209 1005 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:09:45
Subject Length Description Subject Range Query Range Score Percent Strand
Rpb10-RA 405 CG13628-RA 108..308 9..209 1005 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:09:43
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 24717795..24717901 103..209 535 100 Plus
3R 32079331 3R 24717618..24717712 9..103 475 100 Plus
Blast to na_te.dros performed on 2014-11-28 21:09:45 has no hits.

MXO01001.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-21 20:23:08 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-PA 1..204 9..212 99   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:14:28 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13628-PA 1..204 9..212 99   Plus
Sim4 to dmel-all-transcript-r4.3.fasta performed 2006-07-14 13:26:30 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13628-RA 65..269 9..213 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:57:11 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-RA 108..312 9..213 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:43:39 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-RA 108..312 9..213 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:43:39 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 24717618..24717712 9..103 100 -> Plus
3R 24717796..24717905 104..213 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:57:11 Download gff for MXO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 20543340..20543434 9..103 100 -> Plus
arm_3R 20543518..20543627 104..213 98   Plus