Clone MXO01034 Report

Search the DGRC for MXO01034

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:10
Well:34
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptct-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO01034.5prime Sequence

795 bp (795 high quality bases) assembled on 2006-12-21

> MXO01034.5prime
CAGTCGACATGATGATGATGGAGGCGGCAGCCGCGGCAGCAGCGGCGGCA
TTGCAACAGCAGCAGCAACAGCAATCACCACTCCATTCGCCGGCGAATGA
AGTTGCGATTCCCACAGAACAGCCAGCGGCAACAGTGGCAACAGGAGCCG
CTGCTGCAGCAGCCGCAGCAGCAACACCGATTGCAACTGGCAACGTCAAA
AGCGGCAGCACCACCAGCAACGCCAATCACACCAACAGCAACAATAGTCA
CCAGGACGAGGAGGAGCTGGACGATGAGGAGGAGGACGAGGAGGAGGATG
AGGACGAGGATGATGAGGAGGAGAATGCCTCGATGCAATCGAATGCTGAT
GATATGGAGCTGGATGCGCAGCAAGAAACCAGAACTGAGCCAAGTGCAAC
AACACAACAGCAGCATCAGCAGCAGGATACAGAGGATCTTGAGGAGAACA
AGGATGCGGGGGAGGCTAGTTTAAATGTTAGCAATAATCACAATACAACC
GATAGCAATAATAGTTGTAGTCGAAAGAACAACAATGGCGGCAATGAAAG
TGAGCAACATGTGGCCAGTTCGGCGGAGGACGATGATTGCGCCAACAACA
ATACAAATACCAGCAATAACAACAATACCAGCAACACCGCCACCAGCAAC
ACGAACAACAACAATAATAATAACAGCAGCAGCGGCAACAGCGAGAAGCG
CAAGAAGAAGAACAATAACAACAACAACGGCCAGCCTGCTGTTCTATTAG
CTGCCAAAGATAAAGAGGTAAGTTTCAACGCAAGCTTTCTAGACC

MXO01034.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-07 22:20:27
Subject Length Description Subject Range Query Range Score Percent Strand
CG11387-PB 774 ct-RB 1..771 9..779 3855 100 Plus
CG11387-PA 6528 ct-RA 565..1323 9..767 3795 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:11:31
Subject Length Description Subject Range Query Range Score Percent Strand
ct-RE 11035 CG11387-RE 833..1591 9..767 3795 100 Plus
ct-RD 10732 CG11387-RD 593..1351 9..767 3795 100 Plus
ct-RC 11062 CG11387-RC 923..1681 9..767 3795 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:11:25
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7646221..7646991 9..779 3855 100 Plus
Blast to na_te.dros performed 2014-11-28 19:11:28
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2325..3051 25..780 333 54.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2967 39..731 325 55.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6680..7035 69..421 312 57.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6724..6943 24..260 298 63.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6929 54..255 290 63.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2254..2910 55..731 288 54.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6751..6915 116..286 281 66.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2265..2856 117..725 267 55.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..7002 130..424 260 59.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6765..6898 118..247 255 68.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2308..2430 606..728 246 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2273..2867 167..771 228 55.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2299..2666 361..724 217 57.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6880 167..326 208 61.3 Plus
roo 9092 roo DM_ROO 9092bp 1048..1163 100..212 194 65.5 Plus
roo 9092 roo DM_ROO 9092bp 1088..1173 115..201 189 70.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2764..2895 125..254 178 61.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6855 191..325 177 60 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2499..2663 28..180 176 62.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2796..2955 115..267 173 59 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3255..3375 124..246 168 64 Plus
roo 9092 roo DM_ROO 9092bp 1058..1157 626..731 165 65.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6927 210..427 163 57.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6757..7112 368..725 162 54.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 7142..7200 185..243 132 73.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1485..1614 93..220 122 60.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6822..6912 358..448 121 62 Plus
roo 9092 roo DM_ROO 9092bp 1090..1146 368..427 121 71.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1524..1589 191..253 115 68.2 Plus
TART-A 13424 TART-A 13424bp 8639..8677 159..197 114 76.9 Plus

MXO01034.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed on 2007-01-21 20:24:01 has no hits.
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:14:40 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11387-PB 1..774 9..783 99   Plus
Sim4 to dmel-all-transcript-r4.3.fasta performed 2006-07-14 13:27:38 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11387-RB 583..1362 1..783 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:25:34 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
ct-RC 917..1681 1..767 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:42:30 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
ct-RC 917..1681 1..767 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:42:30 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7646215..7646994 1..783 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:25:34 Download gff for MXO01034.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 7540248..7541027 1..783 99   Plus