Clone MXO02431 Report

Search the DGRC for MXO02431

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:24
Well:31
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptac-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO02431.3prime Sequence

185 bp (179 high quality bases) assembled on 2006-12-21

> MXO02431.3prime
ATGGTCTAGAAAGCTTGCCCCGTCGTCCTGCCAGAGTGATATATAGTCGA
GGATGTCCTCATCTTCAGTACCAGAACTGCAGGAATTGTTACGGTAGTCT
TCAAAACTGGCTTCCAACTTGGTATGAAAATTGTTAGGAGGTGTTGCTCC
CGGAATCGTCGATGTTGCTGGGTTGCAATAAGAGC

MXO02431.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-07 22:22:50
Subject Length Description Subject Range Query Range Score Percent Strand
CG3796-PA 606 ac-RA 437..600 185..22 795 99.3 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:29:33
Subject Length Description Subject Range Query Range Score Percent Strand
ac-RA 917 CG3796-RA 500..663 185..22 805 99.4 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:29:31
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 370530..370693 185..22 805 99.4 Minus
Blast to na_te.dros performed on 2014-11-28 21:29:32 has no hits.

MXO02431.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed on 2007-01-21 20:27:08 has no hits.
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:20:33 Download gff for MXO02431.3prime
Subject Subject Range Query Range Percent Splice Strand
CG3796-PA 437..606 15..185 97   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:34:38 Download gff for MXO02431.3prime
Subject Subject Range Query Range Percent Splice Strand
ac-RA 500..669 15..185 97   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:24:22 Download gff for MXO02431.3prime
Subject Subject Range Query Range Percent Splice Strand
ac-RA 500..669 15..185 97   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:24:22 Download gff for MXO02431.3prime
Subject Subject Range Query Range Percent Splice Strand
X 370530..370699 15..185 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:34:38 Download gff for MXO02431.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 264563..264732 15..185 97   Minus

MXO02431.5prime Sequence

627 bp (608 high quality bases) assembled on 2006-12-21

> MXO02431.5prime
CAGTCGACATGGCTTTGGGCAGCGAAAATCACTCTGTTTTCAACGACGAC
GAGGAGTCATCTTCGGCCTTTAATGGACCCTCTGTTATCCGGAGAAATGC
CCGGGAACGCAACCGCGTAAAGCAGGTCAACAATGGCTTCAGCCAACTAC
GACAACATATCCCTGCGGCCGTAATAGCCGATTTAAGCAATGGTCGCCGG
GGAATTGGTCCCGGCGCCAATAAAAAACTGAGCAAAGTTAGCACACTGAA
AATGGCAGTAGAGTACATACGGCGCTTGCAGAAAGTTCTTCATGAAAACG
ACCAGCAGAAACAGAAACAGTTGCATTTGCAGCAGCAACATTTGCACTTT
CGGCAGCAGCAACAGCATCAACACTTATACGCCTGGCACCAAGAGTTGCA
GTTGCAATCTCCAACTGGCAGCACAAGTTCCTGCAACAGCATTAGCTCTT
ATTGCAAGCCAGCAACATCGACGATTCCGGGAGCAACACCTCCTAACAAT
TTTCATACCAAGTTGGAAGCCAGTTTTGAAGACTACCGTAACAATTCCTG
CAGTTCTGGTACTGAAGATGAGGACATCCTCGACTATATATCACTCTGGC
AGGACGACCTGACAAGCTTTCTAGACC

MXO02431.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-07 22:22:51
Subject Length Description Subject Range Query Range Score Percent Strand
CG3796-PA 606 ac-RA 1..603 9..611 2990 99.8 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:46:05
Subject Length Description Subject Range Query Range Score Percent Strand
ac-RA 917 CG3796-RA 64..666 9..611 3000 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:46:02
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 370094..370696 9..611 3000 99.8 Plus
Blast to na_te.dros performed 2014-11-28 19:46:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2744..2955 291..490 227 63.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6727..6925 278..492 210 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6646..6917 224..490 203 59.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6713..6946 233..471 200 57.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2334..2552 279..501 196 58.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6736..6920 278..469 196 59.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2300..2481 293..472 178 58.8 Plus
roo 9092 roo DM_ROO 9092bp 1059..1134 298..373 173 69.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6851 316..446 171 60.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2360..2524 278..441 165 59.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6802..6997 278..471 165 58.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2267..2439 295..472 157 59.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2388..2557 279..455 155 59 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6734..6875 351..490 155 59.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6781..6873 278..373 149 63.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6855..6923 301..369 147 68.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2791..2972 301..486 146 59.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2446..2524 295..373 143 64.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1579 306..373 137 72.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2620..2796 301..490 136 58.3 Plus
roo 9092 roo DM_ROO 9092bp 1064..1146 291..373 136 62.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2411..2500 278..373 133 63.5 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 973..1033 310..369 131 70.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1463..1607 233..376 128 58.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2586..2656 297..373 128 67.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1614 333..436 118 62.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2466..2668 291..501 118 57.1 Plus
roo 9092 roo DM_ROO 9092bp 1063..1113 323..373 111 68.6 Plus
roo 9092 roo DM_ROO 9092bp 1066..1149 255..340 110 62.1 Plus

MXO02431.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed on 2007-01-21 20:27:10 has no hits.
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:20:33 Download gff for MXO02431.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3796-PA 1..606 9..615 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:44:30 Download gff for MXO02431.5prime
Subject Subject Range Query Range Percent Splice Strand
ac-RA 64..669 9..615 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:19:40 Download gff for MXO02431.5prime
Subject Subject Range Query Range Percent Splice Strand
ac-RA 64..669 9..615 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:19:40 Download gff for MXO02431.5prime
Subject Subject Range Query Range Percent Splice Strand
X 370094..370699 9..615 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:44:30 Download gff for MXO02431.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 264127..264732 9..615 99   Plus