Clone MXO02576 Report

Search the DGRC for MXO02576

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:25
Well:76
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptCG11656-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO02576.5prime Sequence

22 bp (21 high quality bases) assembled on 2007-04-16

> MXO02576.5prime
CAATCCACATGGAAACTGATAA

MXO02576.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:10:30
Subject Length Description Subject Range Query Range Score Percent Strand
CG5711-PA 1095 Arr1-RA 1..839 9..847 4195 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 20:09:55 has no hits.
Blast to na_all.dmel.RELEASE6 performed on 2014-11-28 20:09:54 has no hits.
Blast to na_te.dros performed on 2014-11-28 20:09:54 has no hits.

MXO02576.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:22:01 Download gff for MXO02576.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5711-PA 1..839 9..847 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 20:53:23 has no hits.
Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 20:53:23 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2008-04-18 18:31:36 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-04 23:28:00 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-04 23:28:00 has no hits.