Clone MXO02605 Report

Search the DGRC for MXO02605

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:26
Well:5
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptFibp-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO02605.5prime Sequence

317 bp (19 high quality bases) assembled on 2007-04-10

> MXO02605.5prime
CAATCCACATGGGCGCTCCCATCGACCTGATTGCATCGGATGTACTGGAT
CATTACCGCACCTATTCCCTGATTGAACTATACCTAAACGCACCCACCAA
ACTGATGGAACAATCCTGCTTCCAGCTGGATCCACAAATGCGTGACCTTA
TCACCGATAACTACTATTCCATCGATGATGTGGTGGCTCGCTAAATTCTT
GGCAAGAAGCTGTCGTCCCGCTACCGCAAGGACCTCGACAAGGTGGCCGA
AAAGACGTGCGTCAAGCTAAAATCATTTCGCCGACAATTTGACAACGTAA
AACGCATTTTTAAGGCA

MXO02605.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 06:06:50
Subject Length Description Subject Range Query Range Score Percent Strand
CG8660-PD 1194 Fibp-RD 246..555 8..317 1325 97 Plus
CG8660-PB 948 Fibp-RB 1..309 9..317 1320 97 Plus
CG8660-PC 948 Fibp-RC 1..309 9..317 1320 97 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:56:49
Subject Length Description Subject Range Query Range Score Percent Strand
Fibp-RG 1166 CG8660-RG 167..476 8..317 1415 97.1 Plus
Fibp-RF 1233 CG8660-RF 167..476 8..317 1415 97.1 Plus
Fibp-RE 1330 CG8660-RE 344..653 8..317 1415 97.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:56:47
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19817231..19817503 280..8 1230 96.7 Minus
3L 28110227 3L 19817131..19817168 317..280 190 100 Minus
Blast to na_te.dros performed on 2014-11-28 19:56:48 has no hits.

MXO02605.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:22:11 Download gff for MXO02605.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8660-PD 241..554 1..316 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:46:44 Download gff for MXO02605.5prime
Subject Subject Range Query Range Percent Splice Strand
Fibp-RE 339..652 1..316 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:31:50 Download gff for MXO02605.5prime
Subject Subject Range Query Range Percent Splice Strand
Fibp-RE 339..652 1..316 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:31:50 Download gff for MXO02605.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19817132..19817167 281..316 100 <- Minus
3L 19817231..19817508 1..280 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:46:44 Download gff for MXO02605.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19810232..19810267 281..316 100 <- Minus
arm_3L 19810331..19810608 1..280 95   Minus