BDGP Sequence Production Resources |
Search the DGRC for MXO02813
Library: | MXO |
Tissue Source: | D. melanogaster |
Created by: | Charles Yu |
Date Registered: | 2006-03-07 |
Comments: | BD Creator expression clones with C-terminus TAP tag for tissue culture |
Original Plate Number: | 28 |
Well: | 13 |
Vector: | pMK33-CTAP-BD |
Associated Gene/Transcript | CG8768-RA |
Protein status: | |
Sequenced Size: | Not sequenced |
22 bp (20 high quality bases) assembled on 2007-05-15
> MXO02813.5prime CAATCCACATGATTATTCCAAA