Clone MXO03023 Report

Search the DGRC for MXO03023

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:30
Well:23
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptCAH1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO03023.5prime Sequence

231 bp (229 high quality bases) assembled on 2007-05-24

> MXO03023.5prime
CAATCGACATGAGCCACCACTGGGGATACACCGAATAGAACGGACCTGCC
CACTGGGCCAAGGAGTACCCACAGGCGTCGGGACATCGTCAGTCGCCCGT
GGATATCACACCCTCCAGCGCCAAGAAGGGCAGCGAACTGAATGTAGCTC
CGCTCAAGTGGAAGTATGTGCCGGAACACACCAAAGGCCTGGTCAATCCT
GGCTATTGCTGGCGCGTGGATGTGAACGGCG

MXO03023.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:23:43
Subject Length Description Subject Range Query Range Score Percent Strand
CG7820-PA 813 CAH1-RA 1..223 9..231 1040 98.6 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:48:24
Subject Length Description Subject Range Query Range Score Percent Strand
CAH1-RA 1456 CG7820-RA 304..526 9..231 1070 98.7 Plus
adat-RA 3003 CG16889-RA 2354..2555 231..42 780 93.1 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:48:22
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 13808808..13808968 42..202 775 98.8 Plus
Blast to na_te.dros performed on 2014-11-28 18:48:23 has no hits.

MXO03023.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:23:45 Download gff for MXO03023.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7820-PA 1..223 9..231 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:21:51 Download gff for MXO03023.5prime
Subject Subject Range Query Range Percent Splice Strand
CAH1-RA 300..526 1..231 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:37:29 Download gff for MXO03023.5prime
Subject Subject Range Query Range Percent Splice Strand
CAH1-RA 300..526 1..231 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:37:29 Download gff for MXO03023.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 13808809..13808967 43..201 98 -> Plus
2L 13809035..13809064 202..231 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:21:51 Download gff for MXO03023.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 13808809..13808967 43..201 98 -> Plus
arm_2L 13809035..13809064 202..231 100   Plus