Clone MXO03903 Report

Search the DGRC for MXO03903

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:39
Well:3
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptCG9300-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO03903.5prime Sequence

106 bp (75 high quality bases) assembled on 2007-07-18

> MXO03903.5prime
CAGTCGACATNTCCAAATTCCTGTCCTACTACAACCTGGTTTCCCATCCC
CGACCCCAAGGAGNNTTTCTGGGCCTAGNCTGCAGAACAGGGAAAATGGG
CAATGT

MXO03903.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:58:56
Subject Length Description Subject Range Query Range Score Percent Strand
CG9300-PA 2022 CG9300-RA 4..30 12..38 135 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:41:10
Subject Length Description Subject Range Query Range Score Percent Strand
CG9300-RA 2156 CG9300-RA 60..148 12..106 335 93.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:41:08
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19552479..19552561 12..99 225 94.3 Plus
Blast to na_te.dros performed on 2014-11-28 19:41:08 has no hits.

MXO03903.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:58:57 Download gff for MXO03903.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9300-PA 1..92 9..106 92   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:46:37 Download gff for MXO03903.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9300-RA 57..148 9..106 92   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:26:16 Download gff for MXO03903.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9300-RA 57..148 9..106 92   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:26:16 Download gff for MXO03903.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19552476..19552567 9..106 92   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:46:37 Download gff for MXO03903.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19545576..19545667 9..106 92   Plus