Clone MXO52554 Report

Search the DGRC for MXO52554

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:525
Well:54
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptyki-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52554.5prime Sequence

193 bp (24 high quality bases) assembled on 2007-04-11

> MXO52554.5prime
CAATCCACATGTGCGCGTGCCTAATCGCTAATATAATTCTATGTAGTTTT
CGTTTGTATACAAGAATTGCCTTTTATATGTTAACGACGATGCCACCCAC
CTTCAATACAAACAGCCTGATCGACAAGGATATCGACGACGAGGACATGC
TTTCGCCGATCAATTCCAACAACCTGCGTGGTGCGGGTCAACC

MXO52554.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 06:46:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG4005-PB 1101 CG4005-RB 1..84 9..92 345 96.4 Plus
CG4005-PA 1101 CG4005-RA 1..84 9..92 345 96.4 Plus
CG4005-PC 1257 CG4005-RC 1..84 9..92 345 96.4 Plus
CG4005-PB 1101 CG4005-RB 96..184 104..193 335 95.5 Plus
CG4005-PA 1101 CG4005-RA 96..184 104..193 335 95.5 Plus
CG4005-PC 1257 CG4005-RC 96..184 104..193 335 95.5 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:47:20
Subject Length Description Subject Range Query Range Score Percent Strand
yki-RF 1525 CG4005-RF 171..354 9..193 735 93.5 Plus
yki-RD 1369 CG4005-RD 171..354 9..193 735 93.5 Plus
yki-RG 1460 CG4005-RG 106..289 9..193 735 93.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:47:19
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24068132..24068315 193..9 710 93.5 Minus
Blast to na_te.dros performed on 2014-11-28 18:47:19 has no hits.

MXO52554.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:24:09 Download gff for MXO52554.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4005-PC 1..184 9..193 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:21:09 Download gff for MXO52554.5prime
Subject Subject Range Query Range Percent Splice Strand
yki-RG 101..289 1..193 91   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:36:51 Download gff for MXO52554.5prime
Subject Subject Range Query Range Percent Splice Strand
yki-RG 101..289 1..193 91   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:36:51 Download gff for MXO52554.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24068132..24068320 1..193 91   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:21:09 Download gff for MXO52554.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19955655..19955843 1..193 91   Minus