Clone MXO52571 Report

Search the DGRC for MXO52571

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:525
Well:71
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptvps24-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52571.5prime Sequence

130 bp (1 high quality bases) assembled on 2007-04-11

> MXO52571.5prime
CAATCGACTTGGGCTTATTCGGCAGACACTCCCAGTAGAGATCCCAAAGA
GCAGGTGCTGGAGTGGACGCATAAGATACGGAAAGAGGGCAACCCGCTGG
ATCTCCAGATCCGAAGGATCCCGCGCGAGG

MXO52571.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 06:48:51
Subject Length Description Subject Range Query Range Score Percent Strand
CG9779-PA 672 CG9779-RA 2..121 10..130 415 94.2 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:09:53
Subject Length Description Subject Range Query Range Score Percent Strand
Vps24-RA 1114 CG9779-RA 118..237 10..130 490 94.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:09:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4310579..4310656 130..53 315 93.6 Minus
Blast to na_te.dros performed on 2014-11-28 20:09:52 has no hits.

MXO52571.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:24:14 Download gff for MXO52571.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9779-PA 2..121 10..130 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:25:10 Download gff for MXO52571.5prime
Subject Subject Range Query Range Percent Splice Strand
vps24-RA 118..237 10..130 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:53:22 Download gff for MXO52571.5prime
Subject Subject Range Query Range Percent Splice Strand
Vps24-RA 118..237 10..130 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:53:22 Download gff for MXO52571.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 4310579..4310654 55..130 93 <- Minus
3R 4310787..4310830 10..54 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:25:10 Download gff for MXO52571.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 136301..136376 55..130 93 <- Minus
arm_3R 136509..136552 10..54 95   Minus