Clone MXO52685 Report

Search the DGRC for MXO52685

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:526
Well:85
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptCdlc2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52685.5prime Sequence

291 bp (291 high quality bases) assembled on 2007-04-02

> MXO52685.5prime
CAGTCGACATGTCGGATCGCAAGGCGGTGATCAAGAACGCTGACATGAGC
GAGGAGATGCAGCAGGACGCTGTTGACTGCGCCACCCAGGCCCTGGAGAA
GTACAACATCGAGAAGGACATCGCCGCCTTCATCAAGAAGGAGTTCGACA
AGAAGTACAACCCCACCTGGCACTGCATCGTGGGCCGCAACTTCGGATCC
TATGTGACCCACGAGACGCGCCACTTCATCTATTTCTACCTGGGCCAGGT
GGCCATTCTGCTCTTCAAGAGCGGTGCAAGCTTTCTAGACC

MXO52685.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:12:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG5450-PA 270 Cdlc2-RA 1..267 9..275 1335 100 Plus
CG5450-PB 270 Cdlc2-RB 1..267 9..275 1335 100 Plus
CG6998-PB 270 ctp-RB 79..218 87..226 250 87.1 Plus
CG6998-PD 270 ctp-RD 79..218 87..226 250 87.1 Plus
CG6998-PA 270 ctp-RA 79..218 87..226 250 87.1 Plus
CG6998-PC 270 ctp-RC 79..218 87..226 250 87.1 Plus
CG6998-PB 270 ctp-RB 1..59 9..67 145 89.8 Plus
CG6998-PD 270 ctp-RD 1..59 9..67 145 89.8 Plus
CG6998-PA 270 ctp-RA 1..59 9..67 145 89.8 Plus
CG6998-PC 270 ctp-RC 1..59 9..67 145 89.8 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:51:33
Subject Length Description Subject Range Query Range Score Percent Strand
Cdlc2-RC 671 CG5450-RC 152..418 9..275 1335 100 Plus
Cdlc2-RB 621 CG5450-RB 102..368 9..275 1335 100 Plus
Cdlc2-RA 675 CG5450-RA 156..422 9..275 1335 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:51:30
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 1344616..1344882 9..275 1335 100 Plus
X 23542271 X 4698295..4698455 115..275 430 84.5 Plus
X 23542271 X 4691737..4691845 9..117 305 85.3 Plus
Blast to na_te.dros performed on 2014-11-28 19:51:31 has no hits.

MXO52685.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:24:52 Download gff for MXO52685.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5450-PA 1..270 9..279 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:43:36 Download gff for MXO52685.5prime
Subject Subject Range Query Range Percent Splice Strand
Cdlc2-RA 147..425 1..279 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:29:09 Download gff for MXO52685.5prime
Subject Subject Range Query Range Percent Splice Strand
Cdlc2-RA 147..425 1..279 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:29:09 Download gff for MXO52685.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 1344607..1344885 1..279 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:43:36 Download gff for MXO52685.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 1344607..1344885 1..279 97   Plus