Clone MXO52692 Report

Search the DGRC for MXO52692

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:526
Well:92
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptMkp3-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52692.5prime Sequence

409 bp (381 high quality bases) assembled on 2007-04-02

> MXO52692.5prime
CAGTCGACATGGGTCTTAGGTCCCTGCGCATTTCCACAACGCAATCCGAT
TCCGCGTGCAGCAGTTCGGCGGAATCGTCGGATTGCGAGAGCTCCAGCCA
CCATCACCACCACCACAGTCACCACAACTACAACGAGGCGCCCGTGGAGA
TAATCCCTGGACTACTCTTCCTGGGAAATGCCACACACAGCTGCGACTCG
GAAGCGTTGAAAAAGTACAATATAAAGTATGTTTTGAATGTGACACCAGA
TTTGCCAAATAAGTTCAAGGAGTCGGGCGACATCAAGTATCTGCAGATTC
CGATCACGGATCACTACTCACAAGATTTGGCCATACATTTCCCGGATGCC
ATACAGTTTATAGAGGAAGCGCGGTCCGCAAGCTCGGTGGTGCTGGTCCA
CTGCCTGGC

MXO52692.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:12:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG14080-PB 1236 Mkp3-RB 511..911 9..409 2005 100 Plus
CG14080-PA 726 Mkp3-RA 1..401 9..409 2005 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:27:45
Subject Length Description Subject Range Query Range Score Percent Strand
Mkp3-RD 4696 CG14080-RD 1214..1614 9..409 2005 100 Plus
Mkp3-RC 3119 CG14080-RC 1214..1614 9..409 2005 100 Plus
Mkp3-RA 2053 CG14080-RA 148..548 9..409 2005 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:27:42
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19069682..19069891 227..18 1050 100 Minus
3L 28110227 3L 19069487..19069624 363..226 690 100 Minus
3L 28110227 3L 19069237..19069284 409..362 240 100 Minus
Blast to na_te.dros performed 2014-11-28 19:27:43
Subject Length Description Subject Range Query Range Score Percent Strand
I-element 5371 I-element DMIFACA 5371bp Derived from M14954 (g157749) (Rel. 44, Last updated, Version 2). 1236..1272 98..133 110 81.1 Plus
gypsy10 6006 gypsy10 GYPSY10 6006bp 2466..2529 207..270 104 62.5 Plus

MXO52692.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:24:55 Download gff for MXO52692.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14080-PA 1..401 9..409 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:29:16 Download gff for MXO52692.5prime
Subject Subject Range Query Range Percent Splice Strand
Mkp3-RA 142..548 1..409 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:16:41 Download gff for MXO52692.5prime
Subject Subject Range Query Range Percent Splice Strand
Mkp3-RA 142..548 1..409 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:16:41 Download gff for MXO52692.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19069237..19069282 364..409 100 <- Minus
3L 19069487..19069622 228..363 100 <- Minus
3L 19069682..19069891 18..227 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:29:16 Download gff for MXO52692.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19062337..19062382 364..409 100 <- Minus
arm_3L 19062587..19062722 228..363 100 <- Minus
arm_3L 19062782..19062991 18..227 100   Minus