Clone MXO52738 Report

Search the DGRC for MXO52738

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:527
Well:38
Vector:pMK33-CTAP-BD
Associated Gene/TranscriptCG2574-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52738.5prime Sequence

220 bp (92 high quality bases) assembled on 2007-04-02

> MXO52738.5prime
CAGTCGACATGTCCAGCGATCAGGCGAATTCCCAAACGGAAATGGAAACG
GAAGCGCGAGCGCGAGCGGAGGTGGAAGTGGAGGTCGAACCAGAAGCCCC
CCCGAGAGCCAGTGTGGNCAGNTCCGTAGAAGAGACGGCACCCAGCACCA
GTCACAGTGCATCGGGAAAATCCACCGAGGCACCACTTACTGGTTGTGTG
GTGCGAATTACCAGCGAAAT

MXO52738.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:13:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG2574-PA 720 CG2574-RA 95..202 103..210 502 98.1 Plus
CG2574-PA 720 CG2574-RA 1..88 9..96 415 98.8 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:39:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG2574-RA 896 CG2574-RA 95..304 9..218 923 95.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:39:41
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 12408955..12409164 9..218 923 95.7 Plus
Blast to na_te.dros performed on 2014-11-28 18:39:41 has no hits.

MXO52738.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:25:10 Download gff for MXO52738.5prime
Subject Subject Range Query Range Percent Splice Strand
CG2574-PA 1..212 9..220 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:16:04 Download gff for MXO52738.5prime
Subject Subject Range Query Range Percent Splice Strand
CG2574-RA 88..306 1..220 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:32:02 Download gff for MXO52738.5prime
Subject Subject Range Query Range Percent Splice Strand
CG2574-RA 88..306 1..220 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:32:02 Download gff for MXO52738.5prime
Subject Subject Range Query Range Percent Splice Strand
X 12408948..12409166 1..220 93   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:16:04 Download gff for MXO52738.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 12302981..12303199 1..220 93   Plus