Clone MXO52776 Report

Search the DGRC for MXO52776

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:527
Well:76
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptrpr-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52776.5prime Sequence

219 bp (219 high quality bases) assembled on 2007-04-02

> MXO52776.5prime
CAGTCGACATGGCAGTGGCATTCTACATACCCGATCAGGCGACTCTGTTG
CGGGAGGCGGAGCAGAAGGAGCAGCAGATCCTTCGCTTGCGGGAGTCACA
GTGGAGATTCCTGGCCACCGTCGTCCTGGAAACCCTGCGCCAGTACACTT
CATGTCATCCGAAGACCGGAAGAAAGTCCGGCAAATATCGCAAGCCATCG
CAAGCAAGCTTTCTAGACC

MXO52776.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:13:53
Subject Length Description Subject Range Query Range Score Percent Strand
CG4319-PA 198 rpr-RA 1..195 9..203 975 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:42:37
Subject Length Description Subject Range Query Range Score Percent Strand
rpr-RA 901 CG4319-RA 201..395 9..203 975 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:42:35
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18398041..18398235 203..9 975 100 Minus
Blast to na_te.dros performed on 2014-11-28 21:42:36 has no hits.

MXO52776.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:25:23 Download gff for MXO52776.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4319-PA 1..198 9..206 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:42:31 Download gff for MXO52776.5prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 1..211 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:30:42 Download gff for MXO52776.5prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 1..211 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:30:42 Download gff for MXO52776.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18398033..18398240 1..211 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:42:31 Download gff for MXO52776.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18391133..18391340 1..211 96   Minus