Clone MXO52785 Report

Search the DGRC for MXO52785

Clone and Library Details

Library:MXO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus TAP tag for tissue culture
Original Plate Number:527
Well:85
Vector:pMK33-CTAP-BD
Associated Gene/Transcriptctp-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

MXO52785.5prime Sequence

291 bp (291 high quality bases) assembled on 2007-04-02

> MXO52785.5prime
CAGTCGACATGTCTGATCGCAAGGCCGTGATTAAAAATGCCGACATGAGC
GAGGAGATGCAGCAGGATGCCGTCGATTGTGCGACACAGGCCCTCGAGAA
GTACAACATTGAAAAGGACATTGCGGCCTACATCAAGAAGGAGTTCGACA
AAAAATACAATCCCACATGGCATTGCATTGTCGGTCGCAACTTTGGATCG
TATGTCACACACGAGACGCGCCACTTTATTTACTTCTATTTGGGCCAGGT
GGCTATTTTACTGTTTAAGAGCGGTGCAAGCTTTCTAGACC

MXO52785.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:14:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG6998-PB 270 ctp-RB 1..267 9..275 1335 100 Plus
CG6998-PD 270 ctp-RD 1..267 9..275 1335 100 Plus
CG6998-PA 270 ctp-RA 1..267 9..275 1335 100 Plus
CG6998-PC 270 ctp-RC 1..267 9..275 1335 100 Plus
CG5450-PA 270 Cdlc2-RA 79..218 87..226 250 87.1 Plus
CG5450-PB 270 Cdlc2-RB 79..218 87..226 250 87.1 Plus
CG5450-PA 270 Cdlc2-RA 1..59 9..67 145 89.8 Plus
CG5450-PB 270 Cdlc2-RB 1..59 9..67 145 89.8 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:11:10
Subject Length Description Subject Range Query Range Score Percent Strand
ctp-RE 4061 CG6998-RE 216..482 9..275 1335 100 Plus
ctp-RC 4416 CG6998-RC 571..837 9..275 1335 100 Plus
ctp-RA 1483 CG6998-RA 216..482 9..275 1335 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:11:08
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 4698295..4698455 115..275 805 100 Plus
2L 23513712 2L 1344616..1344882 9..275 720 84.6 Plus
X 23542271 X 4691737..4691845 9..117 545 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:11:09 has no hits.

MXO52785.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 19:25:27 Download gff for MXO52785.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6998-PA 1..270 9..279 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:28:25 Download gff for MXO52785.5prime
Subject Subject Range Query Range Percent Splice Strand
ctp-RA 208..487 1..280 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:54:05 Download gff for MXO52785.5prime
Subject Subject Range Query Range Percent Splice Strand
ctp-RA 208..487 1..280 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:54:05 Download gff for MXO52785.5prime
Subject Subject Range Query Range Percent Splice Strand
X 4698297..4698460 117..280 98   Plus
X 4691729..4691844 1..116 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:28:25 Download gff for MXO52785.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 4585762..4585877 1..116 97 -> Plus
arm_X 4592330..4592493 117..280 98   Plus