Clone RE05239 Report

Search the DGRC for RE05239

Clone and Library Details

Library:RE
Tissue Source:Drosophila melanogaster embryo
Created by:Piero Carninci, RIKEN Genome Science Laboratory
Date Registered:2000-10-23
Comments:Average reported size from P Carninci is 2.3kb. Directionally cloned:5 end at XhoI, 3 end at BamHI
Original Plate Number:52
Well:39
Vector:pFlc-1
Associated Gene/Transcriptng2-RA
Protein status:RE05239.pep: gold
Preliminary Size:339
Sequenced Size:562

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG14266 2002-01-01 Sim4 clustering to Release 2
CG14266 2002-04-22 Blastp of sequenced clone
CG14266 2003-01-01 Sim4 clustering to Release 3
ng2 2008-04-29 Release 5.5 accounting
ng2 2008-08-15 Release 5.9 accounting
ng2 2008-12-18 5.12 accounting

Clone Sequence Records

RE05239.complete Sequence

562 bp (562 high quality bases) assembled on 2002-04-22

GenBank Submission: AY113385

> RE05239.complete
ACCAGTAGCAAGGCATCTATTGTAGCATTTGCTCACCATGAAGATCACCG
TGGTACTCGTACTTCTCGCCACCTTCCTCGGCTGTGTGATGATCCACGAG
TCGGAGGCGTCCACAACCACCACGTCCACCTCCGCCTCGGCCACTACCAC
TACTTCCGCTTCGGCGACCACCACTACTTCCGCTTCGGCCACCACCACCA
CTTCCGCTTCGGCCACCACAACAACAGCCTCACCTTCCTCGAGCTCAAAA
AAGAAGACTGTCACTCACTATAAGCGAAAGGTCAAGAGGCCAAAGAAGGT
CAGGAAAATCACAAGGAGAAGGGGTCTCAGGAGCCGCAATGGTCGCAGCA
GTAGAAACCGCAGATCGGAAGAATAAGAGATCCAGGACCAATAGAAAATC
CACGCCACTCTCAATGCTGAACCCCAGGAACCAATTGTTTTCTTTTTTTT
TTATTTCTTAGTCCATAAGCTTAACTAACACTACAATAATTCTTTTACAA
GTCAATTAAGGAATCATAAAAAAATATACATATTTTGTGACATGTCAAAA
AAAAAAAAAAAA

RE05239.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 20:55:37
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 547 ng2-RA 3..547 3..547 2710 99.8 Plus
ng1-RA 523 ng1-RA 4..349 3..348 1730 100 Plus
ng1-RA 523 ng1-RA 345..412 359..424 165 85.2 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 17:35:56
Subject Length Description Subject Range Query Range Score Percent Strand
chrX 22417052 chrX 3133644..3134186 546..3 2610 99.1 Minus
chrX 22417052 chrX 3136032..3136377 3..348 1685 99.1 Plus
chrX 22417052 chrX 3133970..3134034 195..131 250 92.3 Minus
chrX 22417052 chrX 3133994..3134058 219..155 250 92.3 Minus
chrX 22417052 chrX 3136160..3136224 155..219 235 90.8 Plus
chrX 22417052 chrX 3136184..3136248 131..195 235 90.8 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:28:12 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 17:35:53
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240025..3240569 547..3 2710 99.8 Minus
X 23542271 X 3242415..3242760 3..348 1730 100 Plus
X 23542271 X 3240353..3240417 195..131 250 92.3 Minus
X 23542271 X 3240377..3240441 219..155 250 92.3 Minus
X 23542271 X 3242543..3242607 155..219 250 92.3 Plus
X 23542271 X 3242567..3242631 131..195 250 92.3 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:14:47
Subject Length Description Subject Range Query Range Score Percent Strand
X 23527363 X 3248123..3248667 547..3 2710 99.8 Minus
X 23527363 X 3250513..3250858 3..348 1730 100 Plus
X 23527363 X 3250854..3250921 359..424 165 85.2 Plus
Blast to na_te.dros performed 2019-03-15 17:35:54
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6409..6525 161..269 108 58.1 Plus

RE05239.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 17:37:02 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
chrX 3133644..3133963 226..546 99 == Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 19:48:56 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 38..376 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:53:23 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 38..376 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 02:40:59 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 38..376 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:35:49 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 38..376 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:42:05 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 38..376 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 01:05:36 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..546 1..546 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:53:23 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..546 1..546 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 02:40:59 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..546 1..546 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:35:50 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..546 1..546 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:42:05 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..546 1..546 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
X 3240026..3240571 1..546 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
X 3240026..3240571 1..546 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
X 3240026..3240571 1..546 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 02:40:59 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134059..3134604 1..546 99   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:18:21 Download gff for RE05239.complete
Subject Subject Range Query Range Percent Splice Strand
X 3248124..3248669 1..546 99   Minus

RE05239.hyp Sequence

Translation from 37 to 375

> RE05239.hyp
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEE*

RE05239.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 13:48:26
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-PA 112 CG14266-PA 1..112 1..112 536 100 Plus
ng1-PA 107 CG10781-PA 1..105 1..105 496 99 Plus
CG33267-PB 94 CG33267-PB 1..90 1..95 257 62.1 Plus
ng3-PB 146 CG10788-PB 1..115 1..110 249 54.7 Plus
CG7377-PA 94 CG7377-PA 1..90 1..95 238 60.4 Plus

RE05239.pep Sequence

Translation from 37 to 375

> RE05239.pep
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEE*

RE05239.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:35:07
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-PA 112 CG14266-PA 1..112 1..112 536 100 Plus
ng1-PA 107 CG10781-PA 1..105 1..105 496 99 Plus
CG33267-PB 94 CG33267-PB 1..90 1..95 257 62.1 Plus
ng3-PB 146 CG10788-PB 1..115 1..110 249 54.7 Plus
CG7377-PA 94 CG7377-PA 1..90 1..95 238 60.4 Plus
CG33268-PA 94 CG33268-PA 1..90 1..95 237 57.9 Plus
CG12546-PA 117 CG12546-PA 1..106 1..112 199 42 Plus
CG14452-PA 117 CG14452-PA 1..106 1..112 199 42 Plus
CG14454-PB 120 CG14454-PB 4..106 6..112 175 41.8 Plus
CG14454-PA 120 CG14454-PA 4..106 6..112 175 41.8 Plus
CG32453-PB 120 CG32453-PB 4..106 6..112 175 41.8 Plus
CG32453-PA 120 CG32453-PA 4..106 6..112 175 41.8 Plus
CG32071-PA 150 CG32071-PA 14..120 6..112 169 37 Plus
CG32188-PA 105 CG32188-PA 4..95 6..109 167 40.4 Plus
CG32189-PA 105 CG32189-PA 4..95 6..109 167 40.4 Plus
CG13135-PC 132 CG13135-PC 38..130 14..107 167 43.8 Plus
CG13135-PA 132 CG13135-PA 38..130 14..107 167 43.8 Plus
CG14453-PA 133 CG14453-PA 4..128 6..112 164 32.8 Plus
nol-PA 130 CG32077-PA 46..130 22..110 155 42.7 Plus
CG14265-PB 119 CG14265-PB 6..113 8..111 140 35.2 Plus
CG15741-PA 135 CG15741-PA 39..129 22..109 137 37.4 Plus
CG12522-PA 137 CG12522-PA 4..118 6..108 137 36.8 Plus
CG14265-PB 119 CG14265-PB 11..118 5..108 136 32.1 Plus
CG12491-PA 157 CG12491-PA 61..146 24..108 135 33.7 Plus
CG34105-PA 157 CG34105-PA 61..146 24..108 135 33.7 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 13:52:01
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE16297-PA 110 GE16297-PA 1..99 1..98 130 55.6 Plus