RE05239.complete Sequence
562 bp (562 high quality bases) assembled on 2002-04-22
GenBank Submission: AY113385
> RE05239.complete
ACCAGTAGCAAGGCATCTATTGTAGCATTTGCTCACCATGAAGATCACCG
TGGTACTCGTACTTCTCGCCACCTTCCTCGGCTGTGTGATGATCCACGAG
TCGGAGGCGTCCACAACCACCACGTCCACCTCCGCCTCGGCCACTACCAC
TACTTCCGCTTCGGCGACCACCACTACTTCCGCTTCGGCCACCACCACCA
CTTCCGCTTCGGCCACCACAACAACAGCCTCACCTTCCTCGAGCTCAAAA
AAGAAGACTGTCACTCACTATAAGCGAAAGGTCAAGAGGCCAAAGAAGGT
CAGGAAAATCACAAGGAGAAGGGGTCTCAGGAGCCGCAATGGTCGCAGCA
GTAGAAACCGCAGATCGGAAGAATAAGAGATCCAGGACCAATAGAAAATC
CACGCCACTCTCAATGCTGAACCCCAGGAACCAATTGTTTTCTTTTTTTT
TTATTTCTTAGTCCATAAGCTTAACTAACACTACAATAATTCTTTTACAA
GTCAATTAAGGAATCATAAAAAAATATACATATTTTGTGACATGTCAAAA
AAAAAAAAAAAA
RE05239.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 20:55:37
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
ng2-RA | 547 | ng2-RA | 3..547 | 3..547 | 2710 | 99.8 | Plus |
ng1-RA | 523 | ng1-RA | 4..349 | 3..348 | 1730 | 100 | Plus |
ng1-RA | 523 | ng1-RA | 345..412 | 359..424 | 165 | 85.2 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-15 17:35:56
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chrX | 22417052 | chrX | 3133644..3134186 | 546..3 | 2610 | 99.1 | Minus |
chrX | 22417052 | chrX | 3136032..3136377 | 3..348 | 1685 | 99.1 | Plus |
chrX | 22417052 | chrX | 3133970..3134034 | 195..131 | 250 | 92.3 | Minus |
chrX | 22417052 | chrX | 3133994..3134058 | 219..155 | 250 | 92.3 | Minus |
chrX | 22417052 | chrX | 3136160..3136224 | 155..219 | 235 | 90.8 | Plus |
chrX | 22417052 | chrX | 3136184..3136248 | 131..195 | 235 | 90.8 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:28:12 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 17:35:53
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
X | 23542271 | X | 3240025..3240569 | 547..3 | 2710 | 99.8 | Minus |
X | 23542271 | X | 3242415..3242760 | 3..348 | 1730 | 100 | Plus |
X | 23542271 | X | 3240353..3240417 | 195..131 | 250 | 92.3 | Minus |
X | 23542271 | X | 3240377..3240441 | 219..155 | 250 | 92.3 | Minus |
X | 23542271 | X | 3242543..3242607 | 155..219 | 250 | 92.3 | Plus |
X | 23542271 | X | 3242567..3242631 | 131..195 | 250 | 92.3 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:14:47
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
X | 23527363 | X | 3248123..3248667 | 547..3 | 2710 | 99.8 | Minus |
X | 23527363 | X | 3250513..3250858 | 3..348 | 1730 | 100 | Plus |
X | 23527363 | X | 3250854..3250921 | 359..424 | 165 | 85.2 | Plus |
Blast to na_te.dros performed 2019-03-15 17:35:54
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6409..6525 | 161..269 | 108 | 58.1 | Plus |
RE05239.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 17:37:02 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chrX | 3133644..3133963 | 226..546 | 99 | == | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 19:48:56 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..339 | 38..376 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:53:23 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..339 | 38..376 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 02:40:59 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..339 | 38..376 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:35:49 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..339 | 38..376 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 21:42:05 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..339 | 38..376 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 01:05:36 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..546 | 1..546 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:53:23 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..546 | 1..546 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 02:40:59 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..546 | 1..546 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:35:50 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..546 | 1..546 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 21:42:05 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
ng2-RA | 1..546 | 1..546 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 3240026..3240571 | 1..546 | 99 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 3240026..3240571 | 1..546 | 99 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 17:37:02 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 3240026..3240571 | 1..546 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 02:40:59 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_X | 3134059..3134604 | 1..546 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:18:21 Download gff for
RE05239.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 3248124..3248669 | 1..546 | 99 | | Minus |
RE05239.hyp Sequence
Translation from 37 to 375
> RE05239.hyp
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEE*
RE05239.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 13:48:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
ng2-PA | 112 | CG14266-PA | 1..112 | 1..112 | 536 | 100 | Plus |
ng1-PA | 107 | CG10781-PA | 1..105 | 1..105 | 496 | 99 | Plus |
CG33267-PB | 94 | CG33267-PB | 1..90 | 1..95 | 257 | 62.1 | Plus |
ng3-PB | 146 | CG10788-PB | 1..115 | 1..110 | 249 | 54.7 | Plus |
CG7377-PA | 94 | CG7377-PA | 1..90 | 1..95 | 238 | 60.4 | Plus |
RE05239.pep Sequence
Translation from 37 to 375
> RE05239.pep
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEE*
RE05239.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:35:07
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
ng2-PA | 112 | CG14266-PA | 1..112 | 1..112 | 536 | 100 | Plus |
ng1-PA | 107 | CG10781-PA | 1..105 | 1..105 | 496 | 99 | Plus |
CG33267-PB | 94 | CG33267-PB | 1..90 | 1..95 | 257 | 62.1 | Plus |
ng3-PB | 146 | CG10788-PB | 1..115 | 1..110 | 249 | 54.7 | Plus |
CG7377-PA | 94 | CG7377-PA | 1..90 | 1..95 | 238 | 60.4 | Plus |
CG33268-PA | 94 | CG33268-PA | 1..90 | 1..95 | 237 | 57.9 | Plus |
CG12546-PA | 117 | CG12546-PA | 1..106 | 1..112 | 199 | 42 | Plus |
CG14452-PA | 117 | CG14452-PA | 1..106 | 1..112 | 199 | 42 | Plus |
CG14454-PB | 120 | CG14454-PB | 4..106 | 6..112 | 175 | 41.8 | Plus |
CG14454-PA | 120 | CG14454-PA | 4..106 | 6..112 | 175 | 41.8 | Plus |
CG32453-PB | 120 | CG32453-PB | 4..106 | 6..112 | 175 | 41.8 | Plus |
CG32453-PA | 120 | CG32453-PA | 4..106 | 6..112 | 175 | 41.8 | Plus |
CG32071-PA | 150 | CG32071-PA | 14..120 | 6..112 | 169 | 37 | Plus |
CG32188-PA | 105 | CG32188-PA | 4..95 | 6..109 | 167 | 40.4 | Plus |
CG32189-PA | 105 | CG32189-PA | 4..95 | 6..109 | 167 | 40.4 | Plus |
CG13135-PC | 132 | CG13135-PC | 38..130 | 14..107 | 167 | 43.8 | Plus |
CG13135-PA | 132 | CG13135-PA | 38..130 | 14..107 | 167 | 43.8 | Plus |
CG14453-PA | 133 | CG14453-PA | 4..128 | 6..112 | 164 | 32.8 | Plus |
nol-PA | 130 | CG32077-PA | 46..130 | 22..110 | 155 | 42.7 | Plus |
CG14265-PB | 119 | CG14265-PB | 6..113 | 8..111 | 140 | 35.2 | Plus |
CG15741-PA | 135 | CG15741-PA | 39..129 | 22..109 | 137 | 37.4 | Plus |
CG12522-PA | 137 | CG12522-PA | 4..118 | 6..108 | 137 | 36.8 | Plus |
CG14265-PB | 119 | CG14265-PB | 11..118 | 5..108 | 136 | 32.1 | Plus |
CG12491-PA | 157 | CG12491-PA | 61..146 | 24..108 | 135 | 33.7 | Plus |
CG34105-PA | 157 | CG34105-PA | 61..146 | 24..108 | 135 | 33.7 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 13:52:01
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE16297-PA | 110 | GE16297-PA | 1..99 | 1..98 | 130 | 55.6 | Plus |