BDGP Sequence Production Resources |
Search the DGRC for RE38782
Library: | RE |
Tissue Source: | Drosophila melanogaster embryo |
Created by: | Piero Carninci, RIKEN Genome Science Laboratory |
Date Registered: | 2000-10-23 |
Comments: | Average reported size from P Carninci is 2.3kb. Directionally cloned:5 end at XhoI, 3 end at BamHI |
Original Plate Number: | 387 |
Well: | 82 |
Vector: | pFlc-1 |
Associated Gene/Transcript | Bacc-RA |
Protein status: | RE38782.pep: gold |
Sequenced Size: | 927 |
Gene | Date | Evidence |
---|---|---|
CG9894 | 2002-01-01 | Sim4 clustering to Release 2 |
CG9894 | 2002-06-10 | Blastp of sequenced clone |
CG9894 | 2003-01-01 | Sim4 clustering to Release 3 |
CG9894 | 2008-04-29 | Release 5.5 accounting |
CG9894 | 2008-08-15 | Release 5.9 accounting |
CG9894 | 2008-12-18 | 5.12 accounting |
927 bp (927 high quality bases) assembled on 2002-06-10
GenBank Submission: AY071349
> RE38782.complete TCAGTCTTGTACGAACCGTCGACGGGAGCACATATCGGTGAAACTAAATA GTTCCGGAAAACCTCAAAGAAACCAATTCAAATATGTCGGCTGCTACGGA ACAACAGAACAACGGCGATGTGGCCGTGGAGAAGGTGGCGGCAGATGATG TGTCTGCTGTCAAGGACGATCTCAAGGCGAAGGCGGCCGCCGAGGATAAG GCCGCTGCTGCCGATGCCGCCGGCGACGCGGCCGACAACGGTACGTCAAA GGACGGCGAGGATGCCGCCGATGCCGCCGCCGCTGCCCCCGCAAAGGAAT CCGTGAAAGGCACCAAGAGGCCAGCAGAAGCCAAATCCGCAGAATCAAAG AAGGCCAAGAAGGCCGCGGCCGCCGATGGAGATTCCGATGAGGAAGAGGC TCTGGAGGAAATCATCGAGGGCGACAGTGAAATCGAGAGCGACGAGTACG ACATCCCCTACGATGGTGAGGAGGATGACATTGAATGTGATGATGATGAT GATGATAATGATGACGGTTCCGGCTCGGACGATCAGGCGTAATAATAATG TAGTCAAAAATACAAACAAAAACAAACAAAAATTTAAATTAATAATAAAT AAAAGTTACAAGCAGAAACAAAACAAAAAAAATATAATAATAAACCAACA AGCAGAAAATAAACCACAACAAGGAGAAAATGAGGAGGAGGAGGAGAAAA AAACCACAAAAAAATCGCAAAAGTATATAATTTTTATGTTTAAGAAATAA TTTTTTATTTCTTACCTTATTTTAATTGTATTTTATGTGTACTTTTTTTA TAAAAAACTACAAAACAAACAAAAATTGTAATTGAAGGCATTTTCGTATA AACGCAACCTATACGGAATCCAACAAAAAGTAAACATCCCCACTATATAC AAGAACAAAACAAAAAAAAAAAAAAAA
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
chr2L | 23010047 | chr2L | 2755972..2756390 | 492..911 | 2035 | 99.5 | Plus |
chr2L | 23010047 | chr2L | 2753088..2753378 | 40..330 | 1455 | 100 | Plus |
chr2L | 23010047 | chr2L | 2755736..2755902 | 330..496 | 820 | 99.4 | Plus |
chr2L | 23010047 | chr2L | 2752518..2752558 | 1..41 | 205 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
2L | 23513712 | 2L | 2756244..2756667 | 492..915 | 2105 | 99.8 | Plus |
2L | 23513712 | 2L | 2753371..2753661 | 40..330 | 1455 | 100 | Plus |
2L | 23513712 | 2L | 2756008..2756174 | 330..496 | 820 | 99.4 | Plus |
2L | 23513712 | 2L | 2752801..2752840 | 1..40 | 200 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
2L | 23513712 | 2L | 2756244..2756667 | 492..915 | 2105 | 99.7 | Plus |
2L | 23513712 | 2L | 2753371..2753661 | 40..330 | 1455 | 100 | Plus |
2L | 23513712 | 2L | 2756008..2756174 | 330..496 | 820 | 99.4 | Plus |
2L | 23513712 | 2L | 2752801..2752840 | 1..40 | 200 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
mdg1 | 7480 | mdg1 DMRTMGD1 7480bp Derived from X59545 (g8507) (Rel. 49, Last updated, Version 4). | 1223..1324 | 622..730 | 114 | 60.6 | Plus |
TAHRE | 10463 | TAHRE OSV 10463bp | 1185..1262 | 588..666 | 113 | 62 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
chr2L | 2752518..2752557 | 1..40 | 100 | -> | Plus |
chr2L | 2753089..2753248 | 41..200 | 100 | == | Plus |
chr2L | 2753341..2753377 | 293..329 | 100 | -> | Plus |
chr2L | 2755736..2755915 | 330..515 | 93 | <- | Plus |
chr2L | 2755996..2756034 | 516..554 | 100 | == | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RA | 1..459 | 84..542 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RA | 1..459 | 84..542 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Bacc-RA | 1..459 | 84..542 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RA | 1..459 | 84..542 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Bacc-RA | 1..459 | 84..542 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RB | 3..856 | 1..854 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RB | 3..856 | 1..854 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Bacc-RB | 2..912 | 1..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG9894-RB | 3..856 | 1..854 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
Bacc-RB | 2..912 | 1..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
2L | 2752801..2752840 | 1..40 | 100 | -> | Plus |
2L | 2753372..2753660 | 41..329 | 100 | -> | Plus |
2L | 2756008..2756170 | 330..492 | 100 | -> | Plus |
2L | 2756245..2756663 | 493..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
2L | 2752801..2752840 | 1..40 | 100 | -> | Plus |
2L | 2753372..2753660 | 41..329 | 100 | -> | Plus |
2L | 2756008..2756170 | 330..492 | 100 | -> | Plus |
2L | 2756245..2756663 | 493..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
2L | 2752801..2752840 | 1..40 | 100 | -> | Plus |
2L | 2753372..2753660 | 41..329 | 100 | -> | Plus |
2L | 2756008..2756170 | 330..492 | 100 | -> | Plus |
2L | 2756245..2756663 | 493..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
arm_2L | 2752801..2752840 | 1..40 | 100 | -> | Plus |
arm_2L | 2753372..2753660 | 41..329 | 100 | -> | Plus |
arm_2L | 2756008..2756170 | 330..492 | 100 | -> | Plus |
arm_2L | 2756245..2756663 | 493..911 | 99 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
2L | 2753372..2753660 | 41..329 | 100 | -> | Plus |
2L | 2756008..2756170 | 330..492 | 100 | -> | Plus |
2L | 2756245..2756663 | 493..911 | 99 | Plus | |
2L | 2752801..2752840 | 1..40 | 100 | -> | Plus |
Translation from 83 to 541
> RE38782.pep MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD QA*
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dana\GF13890-PA | 151 | GF13890-PA | 1..139 | 1..140 | 234 | 90.8 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dere\GG24880-PA | 153 | GG24880-PA | 1..153 | 1..152 | 679 | 99.3 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dgri\GH11167-PA | 160 | GH11167-PA | 1..148 | 1..140 | 206 | 72 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Bacc-PD | 152 | CG9894-PD | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PC | 152 | CG9894-PC | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PA | 152 | CG9894-PA | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PB | 152 | CG9894-PB | 1..152 | 1..152 | 759 | 100 | Plus |
CG13096-PB | 681 | CG13096-PB | 552..675 | 20..150 | 156 | 35.9 | Plus |
CG13096-PA | 681 | CG13096-PA | 552..675 | 20..150 | 156 | 35.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dmoj\GI17879-PA | 158 | GI17879-PA | 1..146 | 1..140 | 232 | 80.8 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dper\GL26578-PA | 150 | GL26578-PA | 1..138 | 1..140 | 199 | 87.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dpse\GA28987-PA | 150 | GA28987-PA | 1..138 | 1..140 | 199 | 87.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsec\GM18362-PA | 137 | GM18362-PA | 1..137 | 1..152 | 600 | 90.1 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsim\GD23177-PA | 152 | GD23177-PA | 1..152 | 1..152 | 690 | 100 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dvir\GJ17379-PA | 159 | GJ17379-PA | 1..147 | 1..140 | 241 | 80.3 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dwil\GK24578-PA | 156 | GK24578-PA | 1..144 | 1..140 | 243 | 77.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dyak\GE18177-PA | 152 | GE18177-PA | 1..152 | 1..152 | 690 | 100 | Plus |
Translation from 83 to 541
> RE38782.hyp MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD QA*
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Bacc-PD | 152 | CG9894-PD | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PC | 152 | CG9894-PC | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PA | 152 | CG9894-PA | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PB | 152 | CG9894-PB | 1..152 | 1..152 | 759 | 100 | Plus |
CG13096-PB | 681 | CG13096-PB | 552..675 | 20..150 | 156 | 35.9 | Plus |