Clone RE38782 Report

Search the DGRC for RE38782

Clone and Library Details

Library:RE
Tissue Source:Drosophila melanogaster embryo
Created by:Piero Carninci, RIKEN Genome Science Laboratory
Date Registered:2000-10-23
Comments:Average reported size from P Carninci is 2.3kb. Directionally cloned:5 end at XhoI, 3 end at BamHI
Original Plate Number:387
Well:82
Vector:pFlc-1
Associated Gene/TranscriptBacc-RA
Protein status:RE38782.pep: gold
Sequenced Size:927

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG9894 2002-01-01 Sim4 clustering to Release 2
CG9894 2002-06-10 Blastp of sequenced clone
CG9894 2003-01-01 Sim4 clustering to Release 3
CG9894 2008-04-29 Release 5.5 accounting
CG9894 2008-08-15 Release 5.9 accounting
CG9894 2008-12-18 5.12 accounting

Clone Sequence Records

RE38782.complete Sequence

927 bp (927 high quality bases) assembled on 2002-06-10

GenBank Submission: AY071349

> RE38782.complete
TCAGTCTTGTACGAACCGTCGACGGGAGCACATATCGGTGAAACTAAATA
GTTCCGGAAAACCTCAAAGAAACCAATTCAAATATGTCGGCTGCTACGGA
ACAACAGAACAACGGCGATGTGGCCGTGGAGAAGGTGGCGGCAGATGATG
TGTCTGCTGTCAAGGACGATCTCAAGGCGAAGGCGGCCGCCGAGGATAAG
GCCGCTGCTGCCGATGCCGCCGGCGACGCGGCCGACAACGGTACGTCAAA
GGACGGCGAGGATGCCGCCGATGCCGCCGCCGCTGCCCCCGCAAAGGAAT
CCGTGAAAGGCACCAAGAGGCCAGCAGAAGCCAAATCCGCAGAATCAAAG
AAGGCCAAGAAGGCCGCGGCCGCCGATGGAGATTCCGATGAGGAAGAGGC
TCTGGAGGAAATCATCGAGGGCGACAGTGAAATCGAGAGCGACGAGTACG
ACATCCCCTACGATGGTGAGGAGGATGACATTGAATGTGATGATGATGAT
GATGATAATGATGACGGTTCCGGCTCGGACGATCAGGCGTAATAATAATG
TAGTCAAAAATACAAACAAAAACAAACAAAAATTTAAATTAATAATAAAT
AAAAGTTACAAGCAGAAACAAAACAAAAAAAATATAATAATAAACCAACA
AGCAGAAAATAAACCACAACAAGGAGAAAATGAGGAGGAGGAGGAGAAAA
AAACCACAAAAAAATCGCAAAAGTATATAATTTTTATGTTTAAGAAATAA
TTTTTTATTTCTTACCTTATTTTAATTGTATTTTATGTGTACTTTTTTTA
TAAAAAACTACAAAACAAACAAAAATTGTAATTGAAGGCATTTTCGTATA
AACGCAACCTATACGGAATCCAACAAAAAGTAAACATCCCCACTATATAC
AAGAACAAAACAAAAAAAAAAAAAAAA

RE38782.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 18:49:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG9894.g 2846 CG9894.g 357..1271 1..915 4560 99.8 Plus
CG9894.f 2661 CG9894.f 357..1271 1..915 4560 99.8 Plus
CG9894.c 1753 CG9894.c 357..1271 1..915 4560 99.8 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-15 19:49:35
Subject Length Description Subject Range Query Range Score Percent Strand
chr2L 23010047 chr2L 2755972..2756390 492..911 2035 99.5 Plus
chr2L 23010047 chr2L 2753088..2753378 40..330 1455 100 Plus
chr2L 23010047 chr2L 2755736..2755902 330..496 820 99.4 Plus
chr2L 23010047 chr2L 2752518..2752558 1..41 205 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:54:00 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-15 19:49:33
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 2756244..2756667 492..915 2105 99.8 Plus
2L 23513712 2L 2753371..2753661 40..330 1455 100 Plus
2L 23513712 2L 2756008..2756174 330..496 820 99.4 Plus
2L 23513712 2L 2752801..2752840 1..40 200 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 20:22:10
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 2756244..2756667 492..915 2105 99.7 Plus
2L 23513712 2L 2753371..2753661 40..330 1455 100 Plus
2L 23513712 2L 2756008..2756174 330..496 820 99.4 Plus
2L 23513712 2L 2752801..2752840 1..40 200 100 Plus
Blast to na_te.dros performed 2019-03-15 19:49:34
Subject Length Description Subject Range Query Range Score Percent Strand
mdg1 7480 mdg1 DMRTMGD1 7480bp Derived from X59545 (g8507) (Rel. 49, Last updated, Version 4). 1223..1324 622..730 114 60.6 Plus
TAHRE 10463 TAHRE OSV 10463bp 1185..1262 588..666 113 62 Plus

RE38782.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-15 19:50:38 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
chr2L 2752518..2752557 1..40 100 -> Plus
chr2L 2753089..2753248 41..200 100 == Plus
chr2L 2753341..2753377 293..329 100 -> Plus
chr2L 2755736..2755915 330..515 93 <- Plus
chr2L 2755996..2756034 516..554 100 == Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 20:14:06 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 1..459 84..542 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 17:24:59 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 1..459 84..542 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 02:58:45 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RA 1..459 84..542 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 18:15:31 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 1..459 84..542 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:24:44 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RA 1..459 84..542 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 20:52:40 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RB 3..856 1..854 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 17:24:59 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RB 3..856 1..854 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 02:58:45 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RB 2..912 1..911 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 18:15:32 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RB 3..856 1..854 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:24:44 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RB 2..912 1..911 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:50:38 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
2L 2752801..2752840 1..40 100 -> Plus
2L 2753372..2753660 41..329 100 -> Plus
2L 2756008..2756170 330..492 100 -> Plus
2L 2756245..2756663 493..911 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:50:38 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
2L 2752801..2752840 1..40 100 -> Plus
2L 2753372..2753660 41..329 100 -> Plus
2L 2756008..2756170 330..492 100 -> Plus
2L 2756245..2756663 493..911 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-15 19:50:38 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
2L 2752801..2752840 1..40 100 -> Plus
2L 2753372..2753660 41..329 100 -> Plus
2L 2756008..2756170 330..492 100 -> Plus
2L 2756245..2756663 493..911 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 02:58:45 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 2752801..2752840 1..40 100 -> Plus
arm_2L 2753372..2753660 41..329 100 -> Plus
arm_2L 2756008..2756170 330..492 100 -> Plus
arm_2L 2756245..2756663 493..911 99   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 14:48:40 Download gff for RE38782.complete
Subject Subject Range Query Range Percent Splice Strand
2L 2753372..2753660 41..329 100 -> Plus
2L 2756008..2756170 330..492 100 -> Plus
2L 2756245..2756663 493..911 99   Plus
2L 2752801..2752840 1..40 100 -> Plus

RE38782.pep Sequence

Translation from 83 to 541

> RE38782.pep
MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA
DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD
SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD
QA*

RE38782.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 05:50:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF13890-PA 151 GF13890-PA 1..139 1..140 234 90.8 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 05:50:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG24880-PA 153 GG24880-PA 1..153 1..152 679 99.3 Plus
Blast to dgri-all-translation-r1.3.fasta performed 2019-03-16 05:50:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dgri\GH11167-PA 160 GH11167-PA 1..148 1..140 206 72 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:17:42
Subject Length Description Subject Range Query Range Score Percent Strand
Bacc-PD 152 CG9894-PD 1..152 1..152 759 100 Plus
Bacc-PC 152 CG9894-PC 1..152 1..152 759 100 Plus
Bacc-PA 152 CG9894-PA 1..152 1..152 759 100 Plus
Bacc-PB 152 CG9894-PB 1..152 1..152 759 100 Plus
CG13096-PB 681 CG13096-PB 552..675 20..150 156 35.9 Plus
CG13096-PA 681 CG13096-PA 552..675 20..150 156 35.9 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-16 05:50:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI17879-PA 158 GI17879-PA 1..146 1..140 232 80.8 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 05:50:13
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL26578-PA 150 GL26578-PA 1..138 1..140 199 87.9 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 05:50:14
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA28987-PA 150 GA28987-PA 1..138 1..140 199 87.9 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 05:50:14
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM18362-PA 137 GM18362-PA 1..137 1..152 600 90.1 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 05:50:15
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD23177-PA 152 GD23177-PA 1..152 1..152 690 100 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-16 05:50:15
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ17379-PA 159 GJ17379-PA 1..147 1..140 241 80.3 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-16 05:50:16
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK24578-PA 156 GK24578-PA 1..144 1..140 243 77.9 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 05:50:16
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE18177-PA 152 GE18177-PA 1..152 1..152 690 100 Plus

RE38782.hyp Sequence

Translation from 83 to 541

> RE38782.hyp
MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA
DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD
SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD
QA*

RE38782.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:53:20
Subject Length Description Subject Range Query Range Score Percent Strand
Bacc-PD 152 CG9894-PD 1..152 1..152 759 100 Plus
Bacc-PC 152 CG9894-PC 1..152 1..152 759 100 Plus
Bacc-PA 152 CG9894-PA 1..152 1..152 759 100 Plus
Bacc-PB 152 CG9894-PB 1..152 1..152 759 100 Plus
CG13096-PB 681 CG13096-PB 552..675 20..150 156 35.9 Plus