RE39957.complete Sequence
445 bp (445 high quality bases) assembled on 2003-01-22
GenBank Submission: AY075485
> RE39957.complete
ACTAGTTCCTGATCTTCTACGAACCCTATCGTCATGCGCTTTCTACTAGC
TCTCTCCCTGGCCGTCCTGGTCGTTCTGATCCTCCACAGCAGCCAGGTGT
CCTCCACATCAACCACCACCTCCACAAGTGCTTCGGCCACAACCACCACG
GCTGCTACGACAACAACTGATTCGTCCACCACCACCACCACCGAATCCTC
CACGACCACCACTGCCTCCACAAAGAAGAAGCACCGACGCCGCCGTGTCA
TCATCAGGCGCGTGATCATCCGCCGTGGCAGGGAAGGACGAAGTGAGAGC
GGAGACAATCGCCGACGGGTCGTCGTACGCGTTCGCAGGACGGCCAACTG
AAACACCAGATTAATGGTTATTTTCTTTAAAGCCCGTTGCTGTCAATCAA
AATAAATCATTGAAAAATTATTTTCTATCGAAAAAAAAAAAAAAA
RE39957.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 18:24:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32189-RA | 431 | CG32189-RA | 3..431 | 3..431 | 2145 | 100 | Plus |
CG32188-RA | 318 | CG32188-RA | 1..316 | 34..349 | 1520 | 98.7 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 05:49:04
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr3L | 24539361 | chr3L | 17824356..17824783 | 430..3 | 2140 | 100 | Minus |
chr3L | 24539361 | chr3L | 17822888..17823234 | 349..3 | 1675 | 98.8 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:54:45 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 05:49:02
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 17834744..17835172 | 431..3 | 2145 | 100 | Minus |
3L | 28110227 | 3L | 17833279..17833625 | 349..3 | 1675 | 98.8 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 20:02:00
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28103327 | 3L | 17827844..17828272 | 431..3 | 2145 | 100 | Minus |
3L | 28103327 | 3L | 17826379..17826725 | 349..3 | 1675 | 98.8 | Minus |
Blast to na_te.dros performed on 2019-03-16 05:49:02 has no hits.
RE39957.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 05:50:22 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr3L | 17824356..17824564 | 222..430 | 100 | == | Minus |
chr3L | 17824675..17824785 | 1..111 | 99 | | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 20:14:46 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..318 | 34..351 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 16:54:36 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..318 | 34..351 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 08:29:10 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..318 | 34..351 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 17:45:41 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..318 | 34..351 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 06:08:18 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..318 | 34..351 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 20:09:39 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..430 | 1..430 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 16:54:36 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..430 | 1..430 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 08:29:10 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..430 | 1..430 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 17:45:41 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..430 | 1..430 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 06:08:18 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32189-RA | 1..430 | 1..430 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 17834745..17835174 | 1..430 | 99 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 17834745..17835174 | 1..430 | 99 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 17834745..17835174 | 1..430 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 08:29:10 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 17827845..17828274 | 1..430 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 14:16:41 Download gff for
RE39957.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 17827845..17828274 | 1..430 | 99 | | Minus |
RE39957.pep Sequence
Translation from 33 to 350
> RE39957.pep
MRFLLALSLAVLVVLILHSSQVSSTSTTTSTSASATTTTAATTTTDSSTT
TTTESSTTTTASTKKKHRRRRVIIRRVIIRRGREGRSESGDNRRRVVVRV
RRTAN*
RE39957.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:05:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32188-PA | 105 | CG32188-PA | 1..105 | 1..105 | 493 | 100 | Plus |
CG32189-PA | 105 | CG32189-PA | 1..105 | 1..105 | 493 | 100 | Plus |
CG32071-PA | 150 | CG32071-PA | 11..115 | 1..95 | 199 | 49.5 | Plus |
CG12522-PA | 137 | CG12522-PA | 1..129 | 1..102 | 190 | 41.9 | Plus |
CG14454-PB | 120 | CG14454-PB | 1..116 | 1..105 | 189 | 45.8 | Plus |
CG14454-PA | 120 | CG14454-PA | 1..116 | 1..105 | 189 | 45.8 | Plus |
CG32453-PB | 120 | CG32453-PB | 1..116 | 1..105 | 189 | 45.8 | Plus |
CG32453-PA | 120 | CG32453-PA | 1..116 | 1..105 | 189 | 45.8 | Plus |
ng2-PA | 112 | CG14266-PA | 6..109 | 4..95 | 167 | 40.4 | Plus |
ng3-PB | 146 | CG10788-PB | 1..73 | 1..71 | 162 | 52.1 | Plus |
ng1-PA | 107 | CG10781-PA | 6..101 | 4..87 | 160 | 41.7 | Plus |
CG12546-PA | 117 | CG12546-PA | 1..103 | 1..102 | 157 | 41.7 | Plus |
CG14452-PA | 117 | CG14452-PA | 1..103 | 1..102 | 157 | 41.7 | Plus |
CG33267-PB | 94 | CG33267-PB | 1..94 | 1..90 | 143 | 40.6 | Plus |
CG14453-PA | 133 | CG14453-PA | 1..126 | 1..102 | 140 | 36.5 | Plus |
ng3-PB | 146 | CG10788-PB | 8..116 | 4..105 | 137 | 37.6 | Plus |
RE39957.hyp Sequence
Translation from 33 to 350
> RE39957.hyp
MRFLLALSLAVLVVLILHSSQVSSTSTTTSTSASATTTTAATTTTDSSTT
TTTESSTTTTASTKKKHRRRRVIIRRVIIRRGREGRSESGDNRRRVVVRV
RRTAN*
RE39957.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 15:58:44
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32189-PA | 105 | CG32189-PA | 1..105 | 1..105 | 493 | 100 | Plus |
CG32188-PA | 105 | CG32188-PA | 1..105 | 1..105 | 493 | 100 | Plus |
CG32071-PA | 150 | CG32071-PA | 11..115 | 1..95 | 199 | 49.5 | Plus |
CG32453-PB | 120 | CG32453-PB | 1..116 | 1..105 | 189 | 45.8 | Plus |
CG32453-PA | 120 | CG32453-PA | 1..116 | 1..105 | 189 | 45.8 | Plus |