Clone RE39957 Report

Search the DGRC for RE39957

Clone and Library Details

Library:RE
Tissue Source:Drosophila melanogaster embryo
Created by:Piero Carninci, RIKEN Genome Science Laboratory
Date Registered:2000-10-23
Comments:Average reported size from P Carninci is 2.3kb. Directionally cloned:5 end at XhoI, 3 end at BamHI
Original Plate Number:399
Well:57
Vector:pFlc-1
Associated Gene/TranscriptCG32188-RA
Protein status:RE39957.pep: gold
Sequenced Size:445

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG14586 2002-01-01 Sim4 clustering to Release 2
CG32189 2003-01-01 Sim4 clustering to Release 3
CG32188 2003-01-22 Blastp of sequenced clone
CG32189 2008-04-29 Release 5.5 accounting
CG32189 2008-08-15 Release 5.9 accounting
CG32189 2008-12-18 5.12 accounting

Clone Sequence Records

RE39957.complete Sequence

445 bp (445 high quality bases) assembled on 2003-01-22

GenBank Submission: AY075485

> RE39957.complete
ACTAGTTCCTGATCTTCTACGAACCCTATCGTCATGCGCTTTCTACTAGC
TCTCTCCCTGGCCGTCCTGGTCGTTCTGATCCTCCACAGCAGCCAGGTGT
CCTCCACATCAACCACCACCTCCACAAGTGCTTCGGCCACAACCACCACG
GCTGCTACGACAACAACTGATTCGTCCACCACCACCACCACCGAATCCTC
CACGACCACCACTGCCTCCACAAAGAAGAAGCACCGACGCCGCCGTGTCA
TCATCAGGCGCGTGATCATCCGCCGTGGCAGGGAAGGACGAAGTGAGAGC
GGAGACAATCGCCGACGGGTCGTCGTACGCGTTCGCAGGACGGCCAACTG
AAACACCAGATTAATGGTTATTTTCTTTAAAGCCCGTTGCTGTCAATCAA
AATAAATCATTGAAAAATTATTTTCTATCGAAAAAAAAAAAAAAA

RE39957.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 18:24:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-RA 431 CG32189-RA 3..431 3..431 2145 100 Plus
CG32188-RA 318 CG32188-RA 1..316 34..349 1520 98.7 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 05:49:04
Subject Length Description Subject Range Query Range Score Percent Strand
chr3L 24539361 chr3L 17824356..17824783 430..3 2140 100 Minus
chr3L 24539361 chr3L 17822888..17823234 349..3 1675 98.8 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:54:45 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 05:49:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17834744..17835172 431..3 2145 100 Minus
3L 28110227 3L 17833279..17833625 349..3 1675 98.8 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 20:02:00
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28103327 3L 17827844..17828272 431..3 2145 100 Minus
3L 28103327 3L 17826379..17826725 349..3 1675 98.8 Minus
Blast to na_te.dros performed on 2019-03-16 05:49:02 has no hits.

RE39957.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 05:50:22 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
chr3L 17824356..17824564 222..430 100 == Minus
chr3L 17824675..17824785 1..111 99   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 20:14:46 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 34..351 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 16:54:36 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 34..351 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 08:29:10 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 34..351 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 17:45:41 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 34..351 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 06:08:18 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 34..351 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 20:09:39 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..430 1..430 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 16:54:36 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..430 1..430 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 08:29:10 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..430 1..430 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 17:45:41 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..430 1..430 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 06:08:18 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..430 1..430 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
3L 17834745..17835174 1..430 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
3L 17834745..17835174 1..430 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:50:22 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
3L 17834745..17835174 1..430 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 08:29:10 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17827845..17828274 1..430 99   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 14:16:41 Download gff for RE39957.complete
Subject Subject Range Query Range Percent Splice Strand
3L 17827845..17828274 1..430 99   Minus

RE39957.pep Sequence

Translation from 33 to 350

> RE39957.pep
MRFLLALSLAVLVVLILHSSQVSSTSTTTSTSASATTTTAATTTTDSSTT
TTTESSTTTTASTKKKHRRRRVIIRRVIIRRGREGRSESGDNRRRVVVRV
RRTAN*

RE39957.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:05:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG32188-PA 105 CG32188-PA 1..105 1..105 493 100 Plus
CG32189-PA 105 CG32189-PA 1..105 1..105 493 100 Plus
CG32071-PA 150 CG32071-PA 11..115 1..95 199 49.5 Plus
CG12522-PA 137 CG12522-PA 1..129 1..102 190 41.9 Plus
CG14454-PB 120 CG14454-PB 1..116 1..105 189 45.8 Plus
CG14454-PA 120 CG14454-PA 1..116 1..105 189 45.8 Plus
CG32453-PB 120 CG32453-PB 1..116 1..105 189 45.8 Plus
CG32453-PA 120 CG32453-PA 1..116 1..105 189 45.8 Plus
ng2-PA 112 CG14266-PA 6..109 4..95 167 40.4 Plus
ng3-PB 146 CG10788-PB 1..73 1..71 162 52.1 Plus
ng1-PA 107 CG10781-PA 6..101 4..87 160 41.7 Plus
CG12546-PA 117 CG12546-PA 1..103 1..102 157 41.7 Plus
CG14452-PA 117 CG14452-PA 1..103 1..102 157 41.7 Plus
CG33267-PB 94 CG33267-PB 1..94 1..90 143 40.6 Plus
CG14453-PA 133 CG14453-PA 1..126 1..102 140 36.5 Plus
ng3-PB 146 CG10788-PB 8..116 4..105 137 37.6 Plus

RE39957.hyp Sequence

Translation from 33 to 350

> RE39957.hyp
MRFLLALSLAVLVVLILHSSQVSSTSTTTSTSASATTTTAATTTTDSSTT
TTTESSTTTTASTKKKHRRRRVIIRRVIIRRGREGRSESGDNRRRVVVRV
RRTAN*

RE39957.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 15:58:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-PA 105 CG32189-PA 1..105 1..105 493 100 Plus
CG32188-PA 105 CG32188-PA 1..105 1..105 493 100 Plus
CG32071-PA 150 CG32071-PA 11..115 1..95 199 49.5 Plus
CG32453-PB 120 CG32453-PB 1..116 1..105 189 45.8 Plus
CG32453-PA 120 CG32453-PA 1..116 1..105 189 45.8 Plus