RT03853.complete Sequence
177 bp assembled on 2009-11-16
GenBank Submission: BT120375.1
> RT03853.complete
ATGGCAATAACTGCAGCAGCAGCAGCAGCAGCGGCGGCAAACAAGCTAAA
CAAGTATTGCTGTGCCGAGAAGCAGCAGCAGCAGCAGCAGCAGCAACAGC
AACAGCAGCCGCAGCAGCAACAGCAACATCAGCAGATAAAAGGCAGACAA
AAGGCACGAGATGTGAGAGACGTCTAG
RT03853.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 16:45:29
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-RA | 177 | Tango8-RA | 1..177 | 1..177 | 885 | 100 | Plus |
tai.c | 7421 | tai.c | 6230..6294 | 71..135 | 235 | 90.7 | Plus |
tai.b | 7424 | tai.b | 6233..6297 | 71..135 | 235 | 90.7 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 04:31:21
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2R | 21145070 | chr2R | 14198874..14199050 | 1..177 | 885 | 100 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:43:10 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 04:31:19
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 18311822..18311998 | 1..177 | 885 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:42:05
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25260384 | 2R | 18313021..18313197 | 1..177 | 885 | 100 | Plus |
2L | 23513712 | 2L | 9244332..9244396 | 71..135 | 235 | 90.7 | Plus |
X | 23527363 | X | 17756933..17756990 | 78..135 | 215 | 91.3 | Plus |
2R | 25260384 | 2R | 20168929..20168988 | 76..135 | 210 | 90 | Plus |
X | 23527363 | X | 5761123..5761182 | 76..135 | 210 | 90 | Plus |
2R | 25260384 | 2R | 14320251..14320312 | 73..134 | 205 | 88.7 | Plus |
3L | 28103327 | 3L | 6785280..6785344 | 71..135 | 190 | 86.1 | Plus |
X | 23527363 | X | 17323301..17323360 | 76..135 | 180 | 86.6 | Plus |
2L | 23513712 | 2L | 1606640..1606702 | 73..135 | 180 | 85.7 | Plus |
Blast to na_te.dros performed on 2019-03-16 04:31:19 has no hits.
RT03853.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 04:32:06 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2R | 14198874..14199050 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-11-16 12:41:11 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:23:08 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:32:25 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 05:42:18 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-11-16 12:41:10 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:23:08 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:32:25 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 05:42:18 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 1..177 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18311822..18311998 | 1..177 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18311822..18311998 | 1..177 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18311822..18311998 | 1..177 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:32:25 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 14199327..14199503 | 1..177 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:10:46 Download gff for
RT03853.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18313021..18313197 | 1..177 | 100 | | Plus |
RT03853.pep Sequence
Translation from 0 to 176
> RT03853.pep
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*
RT03853.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:00:49
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-PA | 58 | CG14503-PA | 1..58 | 1..58 | 293 | 100 | Plus |
RT03853.hyp Sequence
Translation from 1 to 176
> RT03853.hyp
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*
RT03853.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:08:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-PA | 58 | CG14503-PA | 1..58 | 1..58 | 293 | 100 | Plus |