Clone RT03853 Report

Search the DGRC for RT03853

Clone and Library Details

Library:RT
Tissue Source:D melanogaster pooled RNA
Created by:
Date Registered:2006-04-14
Comments:TA cloning vector from Invitrogen
Original Plate Number:38
Well:53
Vector:pCR2.1
Associated Gene/TranscriptTango8-RA
Protein status:RT03853.pep: gold
Sequenced Size:177

Clone Sequence Records

RT03853.complete Sequence

177 bp assembled on 2009-11-16

GenBank Submission: BT120375.1

> RT03853.complete
ATGGCAATAACTGCAGCAGCAGCAGCAGCAGCGGCGGCAAACAAGCTAAA
CAAGTATTGCTGTGCCGAGAAGCAGCAGCAGCAGCAGCAGCAGCAACAGC
AACAGCAGCCGCAGCAGCAACAGCAACATCAGCAGATAAAAGGCAGACAA
AAGGCACGAGATGTGAGAGACGTCTAG

RT03853.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 16:45:29
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-RA 177 Tango8-RA 1..177 1..177 885 100 Plus
tai.c 7421 tai.c 6230..6294 71..135 235 90.7 Plus
tai.b 7424 tai.b 6233..6297 71..135 235 90.7 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 04:31:21
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 14198874..14199050 1..177 885 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:43:10 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 04:31:19
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18311822..18311998 1..177 885 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:42:05
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 18313021..18313197 1..177 885 100 Plus
2L 23513712 2L 9244332..9244396 71..135 235 90.7 Plus
X 23527363 X 17756933..17756990 78..135 215 91.3 Plus
2R 25260384 2R 20168929..20168988 76..135 210 90 Plus
X 23527363 X 5761123..5761182 76..135 210 90 Plus
2R 25260384 2R 14320251..14320312 73..134 205 88.7 Plus
3L 28103327 3L 6785280..6785344 71..135 190 86.1 Plus
X 23527363 X 17323301..17323360 76..135 180 86.6 Plus
2L 23513712 2L 1606640..1606702 73..135 180 85.7 Plus
Blast to na_te.dros performed on 2019-03-16 04:31:19 has no hits.

RT03853.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 04:32:06 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 14198874..14199050 1..177 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-11-16 12:41:11 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 14:23:08 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:32:25 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 05:42:18 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-11-16 12:41:10 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 14:23:08 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:32:25 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 05:42:18 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 1..177 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18311822..18311998 1..177 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18311822..18311998 1..177 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 04:32:06 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18311822..18311998 1..177 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:32:25 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14199327..14199503 1..177 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:10:46 Download gff for RT03853.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18313021..18313197 1..177 100   Plus

RT03853.pep Sequence

Translation from 0 to 176

> RT03853.pep
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*

RT03853.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:00:49
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-PA 58 CG14503-PA 1..58 1..58 293 100 Plus

RT03853.hyp Sequence

Translation from 1 to 176

> RT03853.hyp
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*

RT03853.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:08:40
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-PA 58 CG14503-PA 1..58 1..58 293 100 Plus