Clone SD16005 Report

Search the DGRC for SD16005

Clone and Library Details

Library:SD
Tissue Source:Drosophila melanogaster Schneider L2 cell culture
Created by:Ling Hong
Date Registered:1999-02-25
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:160
Well:5
Vector:pOT2
Associated Gene/Transcriptl(3)neo38-RB
Protein status:SD16005.pep: validated full length
Preliminary Size:228
Sequenced Size:931

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG14725 2002-01-01 Sim4 clustering to Release 2
CG31364 2002-05-18 Blastp of sequenced clone
CG31364 2003-01-01 Sim4 clustering to Release 3
l(3)neo38 2008-08-15 Release 5.9 accounting
l(3)neo38 2008-12-18 5.12 accounting

Clone Sequence Records

SD16005.complete Sequence

931 bp (931 high quality bases) assembled on 2002-05-18

GenBank Submission: AY119215

> SD16005.complete
CACTTCGCCTGCACGGATCGCGCATGAATATTCTGCCCAGCAATCTGGCC
AAGTGACCAAGCCAATTTCGGGAGCAGGGGCCTGGGGCCAGTGTCATATG
CCCGACACTCGGTGCAGCGAAATGTAAAATACCCATCTAAACTACCGATA
AAGGTAACCATGAGAGATTGGATGAAAACGAGTGCCATTAGCCCTCTAAC
GAAATATAAAAACTAAAAACCATCTAAACCATAAGCGAGGAAAAGGGGTG
CGAATATCTCCCAACCGATATACCCAGCGTGCCTCTGGGCACTGTCACTG
TCATTTGCGTCGCAGCGCTGCCGCCGTCCGCGTCCGCGTCGCTTTGCCTG
GCCCAGTGTTTCCGCTTTCTTTCGCCTCGTTGTAATGTTACTTTTAGTTT
GATGTCGGAGCCTCGACGAGCCGGTCGTAAGCGAAATCGTAAGCGAGACT
TTAGTGCGATTCCGCTCCGTTCCGCCGGTTGTGTGTGCGTGTTTAGTTCG
AGCTGAGGCGAAGCAGAAGCAGAATCGGAATCAGAATCCAGCGGAATCGA
GAATCAAAATCGAAACCGAAAGTGGTTCTCCGCGTGTGCGAGCTAGTGTG
TGTGTGTGTGTACGTGTTGTGTTTGGGCCCGCTTTTCTGCTTTTCTACCC
CCGAAAAAGCAAAGCACAGCATAAAACTGTGCGCTCGTAAGCGCGTACGT
GTGTCTATGTGCCTCTGTGTGAGTGCTAGTGTATGAGTGCGACCAGGGGA
AAGGAGGCAAAGAAAAGAAAACCAACCCCCACCAGCGACGGCGGAGAACA
GGAAAACAACAACAGAAGGCACACAACCAGCGCACCACCACCATCATTAC
CATTACCGCCACCACCCACCACAACACTTCGTCATCGTTTCGCGTTGTGC
AGAAAATAATTACAAAAAAAAAAAAAAAAAA

SD16005.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 19:00:35
Subject Length Description Subject Range Query Range Score Percent Strand
l(3)neo38.g 4980 l(3)neo38.g 170..1097 1..928 4550 99.3 Plus
l(3)neo38.q 6517 l(3)neo38.q 170..1097 1..928 4550 99.3 Plus
l(3)neo38.m 3123 l(3)neo38.m 170..1097 1..928 4550 99.3 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 20:18:57
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 7603338..7604127 913..124 3935 99.9 Minus
chr3R 27901430 chr3R 7604484..7604610 127..1 620 99.2 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:56:00 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 20:18:55
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11777817..11778621 928..124 3950 99.4 Minus
3R 32079331 3R 11778978..11779104 127..1 620 99.2 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 20:32:29
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 11518648..11519452 928..124 3950 99.3 Minus
3R 31820162 3R 11519809..11519935 127..1 620 99.2 Minus
Blast to na_te.dros performed 2019-03-16 20:18:56
Subject Length Description Subject Range Query Range Score Percent Strand
gypsy9 5349 gypsy9 GYPSY9 5349bp 614..684 198..267 118 64.8 Plus

SD16005.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 20:20:07 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 7603338..7604127 124..913 95 <- Minus
chr3R 7604488..7604610 1..123 99   Minus
Sim4 to dmel-all-CDS-r5.9.fasta performed on 2008-07-21 18:32:44 has no hits.
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 21:14:35 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 1..913 1..913 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 17:40:50 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 1..913 1..913 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:00:15 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 25..937 1..913 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 18:32:44 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 1..913 1..913 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 15:58:05 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 25..937 1..913 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 20:20:07 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
3R 11777832..11778621 124..913 99 <- Minus
3R 11778982..11779104 1..123 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 20:20:07 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
3R 11777832..11778621 124..913 99 <- Minus
3R 11778982..11779104 1..123 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 20:20:07 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
3R 11777832..11778621 124..913 99 <- Minus
3R 11778982..11779104 1..123 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:00:15 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603554..7604343 124..913 99 <- Minus
arm_3R 7604704..7604826 1..123 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:00:15 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603554..7604343 124..913 99 <- Minus
arm_3R 7604704..7604826 1..123 99   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 15:05:12 Download gff for SD16005.complete
Subject Subject Range Query Range Percent Splice Strand
3R 11518663..11519452 124..913 99 <- Minus
3R 11519813..11519935 1..123 99   Minus

SD16005.pep Sequence

Translation from 732 to 908

> SD16005.pep
MSATRGKEAKKRKPTPTSDGGEQENNNRRHTTSAPPPSLPLPPPPTTTLR
HRFALCRK*

SD16005.pep Blast Records

Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 04:21:46
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG17194-PA 60 GG17194-PA 1..60 1..58 159 83.3 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 04:21:48
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM26072-PA 58 GM26072-PA 1..58 1..58 285 98.3 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 04:21:49
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD20636-PA 58 GD20636-PA 1..58 1..58 285 98.3 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 04:21:50
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE10086-PA 58 GE10086-PA 1..58 1..58 281 96.6 Plus

SD16005.hyp Sequence

Translation from 732 to 908

> SD16005.hyp
MSATRGKEAKKRKPTPTSDGGEQENNNRRHTTSAPPPSLPLPPPPTTTLR
HRFALCRK*
Sequence SD16005.hyp has no blast hits.