Clone SD16330 Report

Search the DGRC for SD16330

Clone and Library Details

Library:SD
Tissue Source:Drosophila melanogaster Schneider L2 cell culture
Created by:Ling Hong
Date Registered:1999-02-25
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:163
Well:30
Vector:pOT2
Associated Gene/TranscriptCG17931-RA
Protein status:SD16330.pep: gold
Sequenced Size:707

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
Lost to the ancients 2009-01-15 I'm sure there was a reason

Clone Sequence Records

SD16330.complete Sequence

707 bp assembled on 2009-01-15

GenBank Submission: BT056324.1

> SD16330.complete
CAGCAGGAATATTTAATATAACGCTAAACAACTTAAATTTACTACTCTCA
AAAGTAGAAGTGTATCAAAATTGTAGCTATTTTCAGTCGAGAACCAAGAA
GGAGCCTTAAAAATGACACGCGGCAACCAACGAGACCTGGCCCGCCAGAA
GAACCAGAAGAAGCAGGCGGATTTGACCAAGGGAAAGCGAACCGATAACC
TCACCGTGGAGCAAAGGAAGGCCAGGGACGCTGAGTTAATGCGGGAGAAG
CAGAAAAAAAAGGAAGAGGCCGCTGCGGCGGGCACAAGCAAATAGTCAAC
CCACTGGCTTGATAGAGATCTGGACTCCCGGTTGCATTTCCGGACAGGTT
AGGCTTATAGTCAGTCGTTCGTCAGCCAAGACCCCGATTCGCCCAAGGAC
CTAGGATAGTTGGTTAGAATGTACATGAAGCAACATACATAATTCACGAG
AATTGTATACAACTACGCATAGATATTACCGGGCTGTACAGCACGCGACA
TAGCAATAGCAATAGCAAGTGCCACCCAAGGACTTCGATTCTGTTCCGGT
TTTTGTTCATTTTCGTTTGCAGTGCTGCTGTACGATAATTAAGTAATCTT
ACATTTTATTTCTCCACCTACCTGACTAAATTATTTACTGTAATGTATAT
ATATAAATTTTCAAATAAAACATAATATGCAGCCGACAGAAAGACTCAAA
AAAAAAA

SD16330.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 21:19:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RA 756 CG17931-RA 64..756 1..693 3465 100 Plus
CG42446-RA 1166 CG42446-RA 593..1166 120..693 2870 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 21:43:00
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 12182831..12183305 697..223 2375 100 Minus
chr3R 27901430 chr3R 12183826..12183945 120..1 600 100 Minus
chr3R 27901430 chr3R 12183373..12183479 226..120 535 100 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:56:08 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 21:42:58
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 16358138..16358614 699..223 2385 100 Minus
3R 32079331 3R 16359134..16359253 120..1 600 100 Minus
3R 32079331 3R 16358682..16358788 226..120 535 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:36:35
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 16098969..16099445 699..223 2385 100 Minus
3R 31820162 3R 16099965..16100084 120..1 600 100 Minus
3R 31820162 3R 16099513..16099619 226..120 535 100 Minus
Blast to na_te.dros performed 2019-03-16 21:42:58
Subject Length Description Subject Range Query Range Score Percent Strand
Tabor 7345 Tabor TABOR 7345bp 6768..6802 642..675 109 82.9 Plus
Dmir\spock 4952 Dmir\spock SPOCK 4952bp Derived from AY144571. 1039..1081 24..66 107 72.1 Plus

SD16330.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 21:43:47 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 12182831..12183302 226..697 100 <- Minus
chr3R 12183374..12183479 120..225 100 <- Minus
chr3R 12183827..12183945 1..119 100   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 17:59:08 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 1..183 113..295 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:28:22 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 1..183 113..295 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 18:00:40 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 1..183 113..295 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:29:32 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 1..183 113..295 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-01-15 12:56:51 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 64..756 1..693 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:28:22 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 64..756 1..693 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:00:40 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 66..762 1..697 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:29:32 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 66..762 1..697 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 21:43:47 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16359135..16359253 1..119 100   Minus
3R 16358140..16358611 226..697 100 <- Minus
3R 16358683..16358788 120..225 100 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 21:43:47 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16359135..16359253 1..119 100   Minus
3R 16358140..16358611 226..697 100 <- Minus
3R 16358683..16358788 120..225 100 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 21:43:47 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16359135..16359253 1..119 100   Minus
3R 16358140..16358611 226..697 100 <- Minus
3R 16358683..16358788 120..225 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:00:40 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 12183862..12184333 226..697 100 <- Minus
arm_3R 12184405..12184510 120..225 100 <- Minus
arm_3R 12184857..12184975 1..119 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:01:07 Download gff for SD16330.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16098971..16099442 226..697 100 <- Minus
3R 16099514..16099619 120..225 100 <- Minus
3R 16099966..16100084 1..119 100   Minus

SD16330.pep Sequence

Translation from 112 to 294

> SD16330.pep
MTRGNQRDLARQKNQKKQADLTKGKRTDNLTVEQRKARDAELMREKQKKK
EEAAAAGTSK*

SD16330.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-15 11:10:00
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF16522-PA 60 GF16522-PA 1..60 1..60 262 91.7 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 11:10:00
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG20026-PA 60 GG20026-PA 1..60 1..60 286 100 Plus
Blast to dgri-all-translation-r1.3.fasta performed 2019-03-15 11:10:01
Subject Length Description Subject Range Query Range Score Percent Strand
Dgri\GH14419-PA 63 GH14419-PA 1..52 1..52 217 90.4 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 11:15:28
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-PD 60 CG17931-PD 1..60 1..60 296 100 Plus
CG17931-PE 60 CG17931-PE 1..60 1..60 296 100 Plus
CG17931-PC 60 CG17931-PC 1..60 1..60 296 100 Plus
CG17931-PA 60 CG17931-PA 1..60 1..60 296 100 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-15 11:10:01
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI24647-PA 67 GI24647-PA 1..52 1..52 211 88.5 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-15 11:10:02
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL22246-PA 60 GL22246-PA 1..60 1..60 261 91.7 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-15 11:10:02
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA27429-PA 60 GA27429-PA 1..60 1..60 262 91.7 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 11:10:02
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM15440-PA 60 GM15440-PA 1..60 1..60 283 98.3 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 11:10:03
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD20296-PA 57 GD20296-PA 1..57 4..60 270 100 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-15 11:10:03
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ23469-PA 67 GJ23469-PA 1..52 1..52 218 90.4 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-15 11:10:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK13508-PA 60 GK13508-PA 1..60 1..60 255 91.7 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 11:10:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE26320-PA 60 GE26320-PA 1..60 1..60 286 100 Plus

SD16330.hyp Sequence

Translation from 112 to 294

> SD16330.hyp
MTRGNQRDLARQKNQKKQADLTKGKRTDNLTVEQRKARDAELMREKQKKK
EEAAAAGTSK*

SD16330.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:43:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-PD 60 CG17931-PD 1..60 1..60 296 100 Plus
CG17931-PC 60 CG17931-PC 1..60 1..60 296 100 Plus
CG17931-PA 60 CG17931-PA 1..60 1..60 296 100 Plus