Clone TA01490 Report

Search the DGRC for TA01490

Clone and Library Details

Library:TA
Tissue Source:D melanogaster total adult RNA
Created by: 
Date Registered:2007-04-30
Comments: 
Original Plate Number:14
Well:90
Vector:pOTB7_DraIII
Associated Gene/TranscriptCG12853-RA
Protein status:TA01490.pep: gold
Sequenced Size:361

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG12853 2008-04-29 Release 5.5 accounting
CG12853 2008-08-15 Release 5.9 accounting
CG12853 2008-12-18 5.12 accounting

Clone Sequence Records

TA01490.complete Sequence

361 bp assembled on 2007-08-08

GenBank Submission: BT031043

> TA01490.complete
ACTTTTTGTCGAAATTTCAAGCGAGCAACATCGATTTTGGCTGATGAAAA
AATCGCTGTGATTTTTTCCAAATTTCTGTGAAAATGCCGGCAAAAAAGGA
ATCAAACAAGGGTGCTAAGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGC
CGACCGCCGATCCTGTGACTTCCGAATCGAACAACGCAGCGGAACCAGCC
GCCAAGGAAGCCAAGGGTTCCAAGAAGGGCAAAGGCAAAAAGAAGTAAGT
TCCCCAACTAGTTTGGTGGAACTAACTTAAAAAGAGGAATTCAATGTTTC
CGTAGAACAATAAACCAATGGTTTAAAGCAACAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA

TA01490.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 17:02:45
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 488 CG12853-RA 68..398 1..331 1655 100 Plus
CG12853.a 704 CG12853.a 68..398 1..331 1655 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 08:29:48
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 10820961..10821219 73..331 1250 98.8 Plus
chr2R 21145070 chr2R 10820819..10820900 1..82 410 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:59:37 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 08:29:46
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14933657..14933915 73..331 1250 98.8 Plus
2R 25286936 2R 14933515..14933596 1..82 410 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:58:01
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 14934856..14935114 73..331 1250 98.8 Plus
2R 25260384 2R 14934714..14934795 1..82 410 100 Plus
Blast to na_te.dros performed on 2019-03-16 08:29:47 has no hits.

TA01490.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 08:30:55 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 10820819..10820900 1..82 100 -> Plus
chr2R 10820971..10821219 83..332 99   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 21:11:44 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..165 84..248 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:00:15 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..165 84..248 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:55:09 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..165 84..248 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:59:48 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..165 84..248 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 09:42:00 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..165 84..248 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:25:28 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..321 11..332 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:00:15 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..329 1..329 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:55:09 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..329 1..329 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:59:48 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..321 11..332 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:42:00 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 1..329 1..329 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14933515..14933596 1..82 100 -> Plus
2R 14933667..14933915 83..332 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14933515..14933596 1..82 100 -> Plus
2R 14933667..14933915 83..332 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14933515..14933596 1..82 100 -> Plus
2R 14933667..14933915 83..332 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:55:09 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10821020..10821101 1..82 100 -> Plus
arm_2R 10821172..10821420 83..332 99   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:35:43 Download gff for TA01490.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14934714..14934795 1..82 100 -> Plus
2R 14934866..14935114 83..332 99   Plus

TA01490.hyp Sequence

Translation from 83 to 247

> TA01490.hyp
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*

TA01490.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:50:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-PA 54 CG12853-PA 1..54 1..54 272 100 Plus

TA01490.pep Sequence

Translation from 83 to 247

> TA01490.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*

TA01490.pep Blast Records

Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:27:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-PA 54 CG12853-PA 1..54 1..54 272 100 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 06:43:50
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM21584-PA 903 GM21584-PA 1..32 1..32 136 90.6 Plus