TA01490.complete Sequence
361 bp assembled on 2007-08-08
GenBank Submission: BT031043
> TA01490.complete
ACTTTTTGTCGAAATTTCAAGCGAGCAACATCGATTTTGGCTGATGAAAA
AATCGCTGTGATTTTTTCCAAATTTCTGTGAAAATGCCGGCAAAAAAGGA
ATCAAACAAGGGTGCTAAGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGC
CGACCGCCGATCCTGTGACTTCCGAATCGAACAACGCAGCGGAACCAGCC
GCCAAGGAAGCCAAGGGTTCCAAGAAGGGCAAAGGCAAAAAGAAGTAAGT
TCCCCAACTAGTTTGGTGGAACTAACTTAAAAAGAGGAATTCAATGTTTC
CGTAGAACAATAAACCAATGGTTTAAAGCAACAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA
TA01490.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 17:02:45
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-RA | 488 | CG12853-RA | 68..398 | 1..331 | 1655 | 100 | Plus |
CG12853.a | 704 | CG12853.a | 68..398 | 1..331 | 1655 | 100 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 08:29:48
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2R | 21145070 | chr2R | 10820961..10821219 | 73..331 | 1250 | 98.8 | Plus |
chr2R | 21145070 | chr2R | 10820819..10820900 | 1..82 | 410 | 100 | Plus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 21:59:37 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 08:29:46
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 14933657..14933915 | 73..331 | 1250 | 98.8 | Plus |
2R | 25286936 | 2R | 14933515..14933596 | 1..82 | 410 | 100 | Plus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 18:58:01
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25260384 | 2R | 14934856..14935114 | 73..331 | 1250 | 98.8 | Plus |
2R | 25260384 | 2R | 14934714..14934795 | 1..82 | 410 | 100 | Plus |
Blast to na_te.dros performed on 2019-03-16 08:29:47 has no hits.
TA01490.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 08:30:55 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2R | 10820819..10820900 | 1..82 | 100 | -> | Plus |
chr2R | 10820971..10821219 | 83..332 | 99 | | Plus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 21:11:44 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..165 | 84..248 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 15:00:15 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..165 | 84..248 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:55:09 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..165 | 84..248 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:59:48 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..165 | 84..248 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 09:42:00 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..165 | 84..248 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 17:25:28 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..321 | 11..332 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 15:00:15 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..329 | 1..329 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:55:09 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..329 | 1..329 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:59:48 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..321 | 11..332 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:42:00 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 1..329 | 1..329 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14933515..14933596 | 1..82 | 100 | -> | Plus |
2R | 14933667..14933915 | 83..332 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14933515..14933596 | 1..82 | 100 | -> | Plus |
2R | 14933667..14933915 | 83..332 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 08:30:55 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14933515..14933596 | 1..82 | 100 | -> | Plus |
2R | 14933667..14933915 | 83..332 | 99 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:55:09 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 10821020..10821101 | 1..82 | 100 | -> | Plus |
arm_2R | 10821172..10821420 | 83..332 | 99 | | Plus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 12:35:43 Download gff for
TA01490.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14934714..14934795 | 1..82 | 100 | -> | Plus |
2R | 14934866..14935114 | 83..332 | 99 | | Plus |
TA01490.hyp Sequence
Translation from 83 to 247
> TA01490.hyp
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*
TA01490.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:50:08
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-PA | 54 | CG12853-PA | 1..54 | 1..54 | 272 | 100 | Plus |
TA01490.pep Sequence
Translation from 83 to 247
> TA01490.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*
TA01490.pep Blast Records
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:27:33
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-PA | 54 | CG12853-PA | 1..54 | 1..54 | 272 | 100 | Plus |
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 06:43:50
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsec\GM21584-PA | 903 | GM21584-PA | 1..32 | 1..32 | 136 | 90.6 | Plus |