Clone UFO01678 Report

Search the DGRC for UFO01678

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:16
Well:78
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/Transcriptcbc-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO01678.5prime Sequence

168 bp (-45 high quality bases) assembled on 2008-10-17

> UFO01678.5prime
CAGTCGACATGTCGGAGGACCAAGGCAAAGACTACACACTGGAGTCCGAC
TCCGAGCTGCGCTTTGAAATCGAGCAGAAGGATGCCAAAGTGCTGGTGTC
CCTGGTCAGTGGATTTGCGGAGCTGTTCGGCACGGAGCTGGTGAAGAAAA
AGCGTACAGTTCGCGTGG

UFO01678.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:32:36
Subject Length Description Subject Range Query Range Score Percent Strand
cbc-RA 1654 CG5970-RA 107..270 8..168 745 98.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:32:34
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 13485192..13485285 101..8 470 100 Minus
2R 25286936 2R 13485072..13485123 153..102 260 100 Minus
Blast to na_te.dros performed on 2014-11-28 20:32:35 has no hits.

UFO01678.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:33:21 Download gff for UFO01678.5prime
Subject Subject Range Query Range Percent Splice Strand
cbc-RA 103..270 1..168 96   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-10-17 12:49:21 Download gff for UFO01678.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5970-RA 108..275 1..168 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:07:00 Download gff for UFO01678.5prime
Subject Subject Range Query Range Percent Splice Strand
cbc-RA 103..270 1..168 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:07:00 Download gff for UFO01678.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 13485054..13485123 102..168 95 <- Minus
2R 13485192..13485289 1..101 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:33:21 Download gff for UFO01678.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9372559..9372628 102..168 95 <- Minus
arm_2R 9372697..9372794 1..101 97   Minus