Clone UFO02782 Report

Search the DGRC for UFO02782

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:27
Well:82
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/Transcriptfal-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO02782.5prime Sequence

215 bp (-60 high quality bases) assembled on 2009-01-14

> UFO02782.5prime
CAGTCGACATGTCAGCCAGCGCAGAGATTCACTCCCTCGCTCAGCGACGG
CGCTCTCTTTCTCTTCCCCTCTCCAACGAACCAAAGAACTCGAAACTCCC
GCTTTCCCAACAACAACTACAACAGCAGCAGCATGGACACCACGAACAAC
AACAACGCCCATCTATGCTTATTGAGGATGAGGGTCACGGAGTAATCGAA
CTGTCAAGCCATATC

UFO02782.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:23:36
Subject Length Description Subject Range Query Range Score Percent Strand
fal-RD 2128 CG9670-RD 380..586 9..215 975 98.1 Plus
fal-RB 1925 CG9670-RB 177..383 9..215 975 98.1 Plus
fal-RC 2519 CG9670-RC 177..332 9..164 765 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:23:33
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19294943..19295098 9..164 765 99.4 Plus
3L 28110227 3L 19297046..19297096 165..215 210 94.1 Plus
Blast to na_te.dros performed 2014-11-28 23:23:34
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2584..2666 73..155 172 67.5 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3275..3323 104..155 145 78.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6782..6829 108..155 141 77.1 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 515..573 92..153 141 72.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2487..2541 108..162 140 72.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2308..2385 79..156 138 64.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2382..2430 108..156 137 75.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6831..6878 109..156 132 75 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2316..2400 71..156 130 62.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2331..2379 108..156 128 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2394..2442 108..156 128 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2484..2546 108..171 128 68.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6740..6788 108..156 128 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6761..6809 108..156 128 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6794..6842 108..156 128 73.5 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 543..591 108..156 128 73.5 Plus
roo 9092 roo DM_ROO 9092bp 1112..1160 108..156 128 73.5 Plus
roo 9092 roo DM_ROO 9092bp 1110..1157 109..159 122 74.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2442..2490 108..156 119 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2880..2928 108..156 119 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6437..6520 117..197 116 61.9 Plus
BS 5142 BS BS 5142bp 2012..2089 108..180 116 68.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1542..1589 108..155 114 70.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6767 109..156 114 70.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2793..2838 108..153 113 71.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2343 120..156 113 78.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2808..2853 108..156 112 73.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6529..6596 116..181 110 64.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2310..2358 108..156 110 69.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2778..2826 108..156 110 69.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6857..6905 108..156 110 69.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6890..6938 108..156 110 69.4 Plus
roo 9092 roo DM_ROO 9092bp 1121..1171 108..161 110 70.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2439..2481 114..159 106 73.9 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 975..1011 120..156 104 75.7 Plus
roo 9092 roo DM_ROO 9092bp 1067..1115 108..156 101 67.3 Plus
roo 9092 roo DM_ROO 9092bp 1100..1148 108..156 101 67.3 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 600..637 93..130 100 73.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1563..1587 108..132 98 88 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2634..2665 108..139 97 78.1 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3596..3618 110..132 97 91.3 Plus

UFO02782.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-03 12:07:00 Download gff for UFO02782.5prime
Subject Subject Range Query Range Percent Splice Strand
fal-RB 167..381 1..215 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:59:26 Download gff for UFO02782.5prime
Subject Subject Range Query Range Percent Splice Strand
fal-RB 169..383 1..215 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:59:57 Download gff for UFO02782.5prime
Subject Subject Range Query Range Percent Splice Strand
fal-RB 169..383 1..215 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:59:57 Download gff for UFO02782.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19294935..19295098 1..164 96 -> Plus
3L 19297046..19297096 165..215 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:59:26 Download gff for UFO02782.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19288035..19288198 1..164 96 -> Plus
arm_3L 19290146..19290196 165..215 94   Plus