Clone UFO03040 Report

Search the DGRC for UFO03040

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:30
Well:40
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/Transcriptgb-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO03040.5prime Sequence

494 bp (493 high quality bases) assembled on 2009-02-18

> UFO03040.5prime
CAGTCGACATGATGAATTACGGTAGGAAAACGCCCTCCACATATCGGTCC
AATCCGTCGGTTTATTCCCATGCCACGGGAAGATCCTCGACGAATTTACA
CTCCAAGATGTCCCGATCCACGCGATCCGTCAGGATTCCTTGGTACCAGC
GACCGTTGCTTAAAAACAATCAGTACATCGATATACAGAAGGGTGCCATG
CTGGTCGGATTGTTTGCCATTTTTCTGTCCCTCTTCACCATCGCCACGAG
CATCTTTGACATCTACTGCTATGCTATGGCTGCGCCAGGATCCACACATT
ATGGCTACTACATCATATCCTATGAGTTCGTCTATGTGGGCAACAAGCAT
GTTCGCAATATGCTCATTGTCTTTGCCCTGTTCTCGCTTATCATGGCGCT
GATAAACTTTGTGACCAGTGTCCTTCTCTGCGTGGCTCTGCGCAAGGAAT
ACCAGAGGGAAGGTTATGCCATGGCTGTGGTCCTTTGCCATATT

UFO03040.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:48:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG8121-RB 1473 CG8121-RB 320..805 8..494 2395 99.6 Plus
CG8121-RC 1298 CG8121-RC 145..630 8..494 2395 99.6 Plus
CG8121-RA 1504 CG8121-RA 148..633 8..494 2395 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:48:41
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9335699..9335839 81..221 705 100 Plus
3R 32079331 3R 9335900..9336029 222..351 650 100 Plus
3R 32079331 3R 9336157..9336253 351..447 485 100 Plus
3R 32079331 3R 9335561..9335635 8..82 375 100 Plus
3R 32079331 3R 9336493..9336529 458..494 185 100 Plus
Blast to na_te.dros performed 2014-11-28 20:48:42
Subject Length Description Subject Range Query Range Score Percent Strand
TAHRE 10463 TAHRE OSV 10463bp 2337..2375 491..453 105 74.4 Minus

UFO03040.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-03 12:06:10 Download gff for UFO03040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8121-RB 313..805 1..494 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:40:50 Download gff for UFO03040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8121-RA 141..633 1..494 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:30:01 Download gff for UFO03040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8121-RA 141..633 1..494 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:30:01 Download gff for UFO03040.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 9335554..9335635 1..82 95 -> Plus
3R 9335701..9335839 83..221 100 -> Plus
3R 9335900..9336029 222..351 100 -> Plus
3R 9336158..9336252 352..446 100 -> Plus
3R 9336483..9336529 447..494 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:40:50 Download gff for UFO03040.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5161276..5161357 1..82 95 -> Plus
arm_3R 5161880..5161974 352..446 100 -> Plus
arm_3R 5162205..5162251 447..494 95   Plus
arm_3R 5161423..5161561 83..221 100 -> Plus
arm_3R 5161622..5161751 222..351 100 -> Plus