Clone UFO04940 Report

Search the DGRC for UFO04940

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:49
Well:40
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/TranscriptCG9628-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO04940.5prime Sequence

191 bp (122 high quality bases) assembled on 2009-06-30

> UFO04940.5prime
CAGTCGACATGAGCTACTTGCGATCGATAGAAATCTCACGCGTCGAAATG
TCGCCGGCTGACGATAATTCCTTTGCCACAACTCATGGAAACAAAAAGGC
CACCTACACGGTGATATGCATCAAGATTGTGGAACTGTGCCTGCTTATAT
GCTGTTTGGGCCGATCGACGAGCCGGCCAACAATTCTCTTC

UFO04940.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:36:17
Subject Length Description Subject Range Query Range Score Percent Strand
CG9628-RC 890 CG9628-RC 173..353 9..188 850 98.3 Plus
CG9628-RB 1053 CG9628-RB 145..325 9..188 850 98.3 Plus
CG9628-RA 1125 CG9628-RA 239..397 31..188 740 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:36:15
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 14627018..14627126 29..137 545 100 Plus
3L 28110227 3L 14627334..14627386 137..188 185 94.3 Plus
Blast to na_te.dros performed 2014-11-28 19:36:16
Subject Length Description Subject Range Query Range Score Percent Strand
transib4 2656 transib4 TRANSIB4 2656bp 1981..2031 22..71 126 74.5 Plus

UFO04940.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-07-30 09:34:46 Download gff for UFO04940.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9628-RB 126..316 1..191 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:16 Download gff for UFO04940.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9628-RB 138..328 1..191 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:14:38 Download gff for UFO04940.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9628-RB 138..328 1..191 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:14:38 Download gff for UFO04940.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 14627020..14627126 31..137 100 -> Plus
3L 14627335..14627389 138..191 92   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:16 Download gff for UFO04940.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 14620120..14620226 31..137 100 -> Plus
arm_3L 14620435..14620489 138..191 92   Plus