Clone UFO07676 Report

Search the DGRC for UFO07676

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:76
Well:76
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/Transcriptotp-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO07676.5prime Sequence

1188 bp (1066 high quality bases) assembled on 2011-07-08

> UFO07676.5prime
CAGTCGACATGCAGCAACAGGATCAGCACCTGGACAAAAACAAGCAGAAG
CGCCACCGCACCCGCTTCACGCCCGCCCAGTTGAACGAGCTGGAGCGCTG
CTTCTCGAAGACGCACTATCCGGACATCTTCATGCGCGAGGAGATCGCCA
TGCGGATTGGCCTCACTGAGTCCCGCGTTCAGGTCTGGTTCCAGAACCGC
CGTGCCAAGTGGAAGAAGCGCAAGAAGACAACCAATGTCTTCCGCACCCC
GGGCGCCCTGCTGCCCTCCCATGGACTTCCGCCGTTTGGGGCCAATATAA
CCAATATCGCCATGGGCGATGGTCTCTGTGGCACGGGAATGTTTGGCGGA
GATCGCTGGAGCGTGGGTGTCAATCCAATGACGGCAGGCGACTCCATGAT
GTACCAGCACAGTGTGGGCGGATTCAGTTGTGGGCCCAGTGGTTCGCCGA
GCGCCACCACCCCGCCGAACATGAACAGCTGCTCCTCGGTGACCCCGCCG
CCACTTTCCGCGCAGCCGAACTCCAGCCAAAACGAGCTGAACGGCGAGCC
CATGCCGCTGCACCAGCAGCAACAACAACAGACTCACCAACATCAGCAAC
AGCAAACTCACCAACACCACCCGATGGCGCCACCAACACCCACACAGCAA
CAGCAGCAGCTTCCGCAGTCTATGCAGTCGCCGTCAGATGGCGCCAACGA
CACACTCCACAGCATCGCAGCGCTGCGGCGGCGGGCGTCCGAACTAAATG
CGATTCCTTCCTACCTACAGATGGCGCCACACAACTACGAACACTACAAT
TCGAATTCCAATTCGGTCTACGCAAGCTTTCTAGACCATTCGTTTGGCGC
GCGGGCCCAGGTAAGTGGTCATAATCATAATCATAATCATAATCATAATC
ACAACTAGCCTAGGAGATCCTGGTCATGACTAGTGCTTGGATTCTCACCA
ATAAAAAACGCCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGA
GTTCTGAGGTCATTACTGGATCTATCACAGGAGTCAAGCGAGCTCGATAT
CAATTACGCCCCCGCCCTGCCACTCATCGCAAGTAACTTGTTGTTATTTC
TTTAAGCATTCTGGCGAACTGAAGCACATATCTAACACAGAAACTGGGCA
TGATGAACATGGAATCGCCCGAGCGGTACATATATCAG

UFO07676.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:11:43
Subject Length Description Subject Range Query Range Score Percent Strand
otp-RJ 2856 CG10036-RJ 1173..1986 8..821 4055 99.9 Plus
otp-RC 2347 CG10036-RC 664..1477 8..821 4055 99.9 Plus
otp-RI 2835 CG10036-RI 1189..1965 45..821 3870 99.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 00:11:36
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20884495..20884762 821..554 1340 100 Minus
2R 25286936 2R 20886522..20886730 388..180 1045 100 Minus
2R 25286936 2R 20885202..20885372 554..384 840 99.4 Minus
2R 25286936 2R 20895709..20895869 184..24 805 100 Minus
Blast to na_te.dros performed 2014-11-27 00:11:40
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6878 562..716 244 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2308..2484 540..721 240 63 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2323..2511 540..729 235 62.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6734..6913 513..683 230 63 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6858 530..667 229 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6757..6934 512..679 224 65.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6835 555..668 209 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2376..2535 555..721 206 63.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2821..3026 468..683 192 58.1 Plus
roo 9092 roo DM_ROO 9092bp 1059..1145 571..660 191 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2391 573..660 189 73 Plus
roo 9092 roo DM_ROO 9092bp 1051..1164 546..661 187 66.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2357..2511 512..660 183 62.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6814 572..668 178 67.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6799..6992 512..716 178 59.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2722..2889 545..716 175 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2712..2902 523..714 173 59.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2709..2979 467..721 171 59.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2439..2534 524..623 166 66 Plus
roo 9092 roo DM_ROO 9092bp 1055..1165 504..614 159 62.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1502..1612 508..621 157 63.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2454..2539 558..644 153 65.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2823..2977 513..667 152 58.6 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 7943..8018 542..618 148 67.5 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 514..577 553..619 148 71.6 Plus
TART-C 11124 TART-C TARTC 11124bp 9387..9462 542..618 148 67.5 Plus
roo 9092 roo DM_ROO 9092bp 1065..1151 535..621 146 65.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2596..2665 589..658 142 70.4 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3228..3342 524..634 141 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1603 567..646 138 65.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6830..6923 510..603 136 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1539..1600 564..620 127 72.6 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 149..195 558..604 127 74.5 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9179..9225 558..604 127 74.5 Plus
BS 5142 BS BS 5142bp 2012..2066 564..621 121 70.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6526..6570 579..622 114 75.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2633..2685 560..612 112 67.9 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3288..3336 555..603 110 69.4 Plus

UFO07676.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-09-21 12:19:50 Download gff for UFO07676.5prime
Subject Subject Range Query Range Percent Splice Strand
otp-RC 657..1484 1..830 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 16:10:02 Download gff for UFO07676.5prime
Subject Subject Range Query Range Percent Splice Strand
otp-RC 658..1485 1..830 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:57:37 Download gff for UFO07676.5prime
Subject Subject Range Query Range Percent Splice Strand
otp-RC 658..1485 1..830 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 00:57:37 Download gff for UFO07676.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20884487..20884761 555..830 98 <- Minus
2R 20885202..20885368 388..554 99 <- Minus
2R 20886523..20886727 183..387 100 <- Minus
2R 20895711..20895866 27..182 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 16:10:02 Download gff for UFO07676.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16771992..16772266 555..830 98 <- Minus
arm_2R 16772707..16772873 388..554 99 <- Minus
arm_2R 16774028..16774232 183..387 100 <- Minus
arm_2R 16783216..16783371 27..182 100 <- Minus