UFO08445.5prime Sequence
488 bp (488 high quality bases) assembled on 2011-07-29
> UFO08445.5prime
CAGTCGACATGCGCCACAATTCGCCAGTGTCCCGGGAGCGAGCCAGCGAG
GCAGCGGCAGCCACTCAGACAGCAGCAGCCACAGCGGGAGGAGCAACTGC
CCACTCAGCCGGAGGAACTGCGGGAGGATCTGCAGCAGCGACGACAACGG
CTGGAGGGGCCACGTCCGGATCCGGAACAGCCTCGGCGAACACGAACAGC
AATTCCTCGGCCTCATCCAGCACAGTGGCAGCTGCACAGGCGGCTGTCTA
CAGCGGCGGCAACACGGTGACCGGAAGTTTGGGCAGCGCCGGGGTGGTGG
CTCGTGGCTTCCGCAGCCACAGTCCCACCCACCGGCGGAGGAGTCGCGAG
CGCCAGCGACGTACGCATGGCTCTGATCAGGGCGGTCTGCTGGCCTACAG
CGGTCTCGTTGGCGTCAACGACATGACGGATTTCTTGGGTCCACAGCAGG
GCGGAGGAGGAGGTGGCGGTGGTGGTGGTGGCGGTGGT
UFO08445.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:25:06
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| Dmtn-RE | 3463 | CG1021-RE | 1150..1629 | 9..488 | 2400 | 100 | Plus |
| Dmtn-RD | 3827 | CG1021-RD | 1514..1993 | 9..488 | 2400 | 100 | Plus |
| Dmtn-RF | 3747 | CG1021-RF | 1434..1913 | 9..488 | 2400 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:25:02
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 3R | 32079331 | 3R | 6391528..6392007 | 488..9 | 2400 | 100 | Minus |
Blast to na_te.dros performed 2014-11-26 17:25:03
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6736..6897 | 51..201 | 192 | 61.3 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6683..6910 | 17..246 | 190 | 56.7 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2327..2518 | 51..236 | 179 | 59.3 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6782..6942 | 44..201 | 176 | 58.4 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6831..6956 | 53..184 | 169 | 61.4 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6778..6956 | 51..229 | 166 | 57.9 | Plus |
| roo | 9092 | roo DM_ROO 9092bp | 1063..1157 | 51..151 | 150 | 63.4 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2796..2929 | 44..170 | 140 | 59.7 | Plus |
| Dsub\bilbo | 5540 | Dsub\bilbo 5540bp Derived from U73803 (Rel. 54, Last updated, Version 1). | 5138..5202 | 72..8 | 127 | 66.2 | Minus |
| Dmer\R1A3 | 3772 | Dmer\R1A3 MERCR1A3 3772bp | 598..708 | 159..51 | 118 | 57.7 | Minus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6887..6945 | 52..110 | 106 | 64.4 | Plus |
UFO08445.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-09-21 12:11:42 Download gff for
UFO08445.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG1021-RD | 1507..1989 | 4..488 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:31:10 Download gff for
UFO08445.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| Dmtn-RF | 1431..1913 | 4..488 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:59:38 Download gff for
UFO08445.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| Dmtn-RF | 1431..1913 | 4..488 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:59:38 Download gff for
UFO08445.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 3R | 6391528..6392010 | 4..488 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:31:10 Download gff for
UFO08445.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_3R | 2217250..2217732 | 4..488 | 99 | | Minus |
