Clone UFO09424 Report

Search the DGRC for UFO09424

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:94
Well:24
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/TranscriptCG42457-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO09424.5prime Sequence

590 bp (589 high quality bases) assembled on 2011-08-17

> UFO09424.5prime
CAGTCGACATTCCCTACAGCAACTGGCTCAAGCTGCTCCACCAGTAACGG
CAGTGGCAGCAGCAGCAACAGCAACCCCCTCAGCGCTGCGGTGCAGCAAC
ATCCGGTGGCATTCATCGAGTTCAAGGACCCACCGACCGCGTCTCAGGCC
ATGCAGCAGCTGCAGGGTAAATATCTGCTCAGCTCCGATCGCGGTTCCAT
CCGCATCGAGTTTGCGCGCAGCAAAATGATCAACGAGGTGACCATAATGA
ACACCAAGGCACCGCCACCACCACCACCCACTGCTGTTGCTGCTACTGTT
GCACCACCGCCACCGCCAGCACCCATGTACATCCTGAACGGCGGTGGGGG
GGTCGAGCATTTGCTGGTCCCAGCACCACCGCCGTCGGCACAGCAGCAGC
AGCAGCAGCAGCAGCAGCAACTCCAGATGCAGCAACTGCAACAGCAGATG
CACCTGCAGCAGCAACATCAACAGCAGCAGCAACTCCAATTGACCGTGGC
AGCACCCTGCACTGCAGCAAGCACCACCACCCACAGCAGCACCACTAGCG
TTGTTGTTAACTCACTACAGCACCACCAACTTCATCATCC

UFO09424.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:07:04
Subject Length Description Subject Range Query Range Score Percent Strand
cpo-RY 6131 CG43738-RY 2838..3412 16..590 2830 99.5 Plus
cpo-RX 6116 CG43738-RX 2876..3450 16..590 2830 99.5 Plus
cpo-RU 5086 CG43738-RU 2893..3467 16..590 2830 99.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 00:06:59
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 18011105..18011679 16..590 2830 99.5 Plus
Blast to na_te.dros performed 2014-11-27 00:07:01
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2370..2949 17..589 278 55.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2766..2971 386..584 256 61.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2740..2854 430..544 178 66.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..7210 14..494 175 56 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2860 42..584 149 53.3 Plus
roo 9092 roo DM_ROO 9092bp 1097..1163 17..84 148 70.6 Plus
roo 9092 roo DM_ROO 9092bp 1073..1164 17..107 141 65.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2766..2853 17..103 139 66.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6737..6802 39..105 134 70.6 Plus
roo 9092 roo DM_ROO 9092bp 1037..1141 2..105 134 62.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6839..6934 17..114 133 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2596..3005 18..453 129 52.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6723..7212 46..552 128 53.9 Plus
roo 9092 roo DM_ROO 9092bp 1079..1142 14..75 126 70.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1521..1588 14..79 119 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6818..6878 14..75 118 67.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6785..6857 14..84 117 64.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1516..1584 15..84 113 64.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1516..1589 37..111 111 64.5 Plus
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 662..727 97..31 107 64.2 Minus

UFO09424.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-09-21 13:45:10 Download gff for UFO09424.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42457-RA 2757..3338 8..590 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 16:11:56 Download gff for UFO09424.5prime
Subject Subject Range Query Range Percent Splice Strand
cpo-RU 2886..3467 8..590 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:59:16 Download gff for UFO09424.5prime
Subject Subject Range Query Range Percent Splice Strand
cpo-RU 2886..3467 8..590 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 00:59:16 Download gff for UFO09424.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 18011098..18011679 8..590 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 16:11:56 Download gff for UFO09424.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 13836820..13837401 8..590 98   Plus