Clone UFO11709 Report

Search the DGRC for UFO11709

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:117
Well:9
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/TranscriptCG14431-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO11709.5prime Sequence

267 bp (192 high quality bases) assembled on 2012-06-28

> UFO11709.5prime
CAGTCGACATGCCGTCGTCAGCAATAAATAAAGCAGCACGCAGTGTTGCC
AATGCGATTCAATTGCTGGCAATCGTTCTCTATTGCTGCTGCATGGTGCA
TGGACAACAGCAGCAGCAGCAGCAGCAGCAGCTACAACCACAACAGCAGC
AACACTTGAAGTACCAGCAATTTGCAATACCAAATGCAGCAGCAATTTGA
ATACCAGCAGCAGCAGCACTACCAGCAGCATTTTCAGCAGCAGCAGCAGC
AACAGCAGCAACAGCAG

UFO11709.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:23:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG14431-RC 7289 CG14431-RC 744..1003 7..267 1250 98.9 Plus
CG14431-RB 5404 CG14431-RB 744..1003 7..267 1250 98.9 Plus
Trl-RK 3145 CG33261-RK 1758..1805 105..152 195 93.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 03:23:04
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6917558..6917817 7..267 1225 98.9 Plus
3L 28110227 3L 14751582..14751629 152..105 195 93.8 Minus
X 23542271 X 10700442..10700496 104..158 185 89.1 Plus
X 23542271 X 9270926..9270976 154..104 180 90.2 Minus
X 23542271 X 10700439..10700486 104..151 180 91.7 Plus
3R 32079331 3R 31613420..31613470 104..154 180 90.2 Plus
Blast to na_te.dros performed 2014-11-28 03:23:06
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6874 107..267 372 72 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6749..6907 105..267 364 71.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6772..6923 104..259 357 71.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2302..2483 100..267 340 68.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6793..6944 104..265 318 70.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2358..2527 105..266 313 68.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6856 127..267 300 69.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2769..2929 105..266 260 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6812..6956 105..250 260 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2431 138..263 249 67.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2785..2956 106..266 241 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6806..6944 105..244 239 66.4 Plus
roo 9092 roo DM_ROO 9092bp 1055..1179 80..209 224 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1532..1613 98..179 203 75 Plus
roo 9092 roo DM_ROO 9092bp 1049..1161 112..230 194 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2414..2563 98..244 193 60.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2758..2909 109..267 186 61.7 Plus
roo 9092 roo DM_ROO 9092bp 1088..1153 105..170 186 75.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6869..7033 105..267 181 60.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2610..2791 105..266 178 62.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1521..1633 105..213 177 64.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6835..6944 98..214 172 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1595 123..201 132 68.3 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 970..1011 109..150 129 78.6 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3247..3340 103..194 117 62.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 128..192 105..169 117 68.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9158..9222 105..169 117 68.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 5633..5697 119..183 109 63.1 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3261..3326 108..173 105 62.1 Plus

UFO11709.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-06-28 10:02:41 Download gff for UFO11709.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14431-RB 1..258 9..267 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:49:36 Download gff for UFO11709.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14431-RB 739..1003 1..267 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:56:21 Download gff for UFO11709.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14431-RB 739..1003 1..267 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:56:21 Download gff for UFO11709.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6917553..6917817 1..267 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:49:36 Download gff for UFO11709.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6811586..6811850 1..267 97   Plus