UFO12338.5prime Sequence
403 bp (233 high quality bases) assembled on 2012-10-16
> UFO12338.5prime
GTCGACATGATGACGCCAGAATCGAAAGCAATACAGCCGGCAGCAGCAAC
AACAAAGCAAACAGCAGAAGCAACAGCAACAACAACAATGGCTCACACAC
AACAAAAGTCGCAGTTGTCAACGTTGGCGAAAACAACAACGACAACGGCA
ACGAATAAGGCGGCCAAAAGCGTTGTCAGCAATGCAAATAGCAGTGGCAA
CAGTTCGAGCACGAGCTGGCTTTGTCTCAGTCTCTGAAACACGCACACAA
CACCACCACGACGACAAAAACACACCGGAGCAGCAGCAACAGAGGCAACA
ACTAATGCTGATTAATGTGCAAAGCCAACAGCACTGGAACACCACTTTTC
CCGTGCTGGCCCCATAAAGTAAAAGTGGAAACCTTTACCACTTGTGGGGA
GTG
UFO12338.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:13:04
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| Psc-RC | 6332 | CG3886-RC | 1006..1392 | 7..382 | 1225 | 89.7 | Plus |
| Psc-RB | 5671 | CG3886-RB | 670..1056 | 7..382 | 1225 | 89.7 | Plus |
| Psc-RA | 6007 | CG3886-RA | 1006..1392 | 7..382 | 1225 | 89.7 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:13:01
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2R | 25286936 | 2R | 12977849..12978163 | 312..7 | 1080 | 92.4 | Minus |
Blast to na_te.dros performed 2014-11-28 18:13:03
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| roo | 9092 | roo DM_ROO 9092bp | 1067..1171 | 38..145 | 155 | 63.3 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2587..2876 | 18..307 | 154 | 57.2 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2310..2473 | 177..344 | 144 | 58 | Plus |
| Doc3-element | 4740 | Doc3-element DOC3 4740bp | 529..632 | 45..151 | 140 | 63 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2270..2425 | 193..344 | 137 | 60.1 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6755..6866 | 228..346 | 126 | 63.3 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6724..6872 | 160..302 | 125 | 60.3 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6527..6779 | 52..302 | 122 | 54.5 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6722..6854 | 177..302 | 107 | 57.9 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6734..6846 | 228..344 | 105 | 63.6 | Plus |
UFO12338.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-10-16 13:32:18 Download gff for
UFO12338.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| Psc-RA | 995..1335 | 1..333 | 91 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:48:26 Download gff for
UFO12338.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| Psc-RA | 1000..1340 | 1..333 | 91 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:53:55 Download gff for
UFO12338.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| Psc-RA | 1000..1340 | 1..333 | 91 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 18:53:55 Download gff for
UFO12338.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2R | 12977823..12978167 | 1..339 | 91 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:48:26 Download gff for
UFO12338.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2R | 8865328..8865672 | 1..339 | 91 | | Minus |
