Clone UFO12367 Report

Search the DGRC for UFO12367

Clone and Library Details

Library:UFO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2008-06-20
Comments:BD Creator expression clones with C-terminus FLAG HA tag for transgenic expression using PhiC31 integrase system
Original Plate Number:123
Well:67
Vector:pUAST-CFLAGHA-BD-PHI
Associated Gene/TranscriptCG5484-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

UFO12367.5prime Sequence

222 bp (156 high quality bases) assembled on 2012-10-16

> UFO12367.5prime
AGTCGACATGAACTACAATCCAAATCCGGGTATGCGGAACCGTAAGTGGG
AGAACTCCTCAGCTGCCGGTCGCCCAAGGCCGCCGAAGCGTGTGAGTGAT
GTTAACGCCATGGGACCCTCGGCTCCGATGATGGGCGGTGGCGCCATCTT
CATGGCCCCGCCCACCGGCCCAGGAATACTATTGCTTTTATGTACTGACA
TCTGCTTTGGTCTGATCAACAT

UFO12367.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:13:53
Subject Length Description Subject Range Query Range Score Percent Strand
CG5484-RC 1522 CG5484-RC 108..281 8..181 840 98.9 Plus
CG5484-RA 1507 CG5484-RA 137..266 52..181 605 97.7 Plus
CG5484-RB 1495 CG5484-RB 130..254 57..181 595 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:13:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 26718328..26718452 57..181 595 98.4 Plus
3R 32079331 3R 26717978..26718026 8..56 245 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:13:52 has no hits.

UFO12367.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-10-16 13:32:34 Download gff for UFO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 125..304 1..181 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:49:00 Download gff for UFO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 102..281 1..181 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:54:29 Download gff for UFO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 102..281 1..181 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 18:54:29 Download gff for UFO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 26718328..26718477 57..205 92 <- Plus
3R 26717972..26718026 1..56 92 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:49:00 Download gff for UFO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 22543694..22543748 1..56 92 -> Plus
arm_3R 22544050..22544199 57..205 92 <- Plus