Clone BO29176 Report

Search the DGRC for BO29176

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:291
Well:76
Vector:pDNR-Dual
Associated Gene/TranscriptCG9775-RD
Protein status:BO29176.pep: Imported from assembly
Sequenced Size:979

Clone Sequence Records

BO29176.complete Sequence

979 bp assembled on 2011-08-26

GenBank Submission: KX797537

> BO29176.complete
GAAGTTATCAGTCGACATGCGTGCCGATCTAGTGGCAAGCGGCAATGCCG
CACGCAATCGCCGCAGCGGCAGCAGCATGCGCAATGTCCCCGCCACTAAC
GGTGGTGGAGGCGGACTTCGGCAGCGGCTAGGACAGCGCCGCCCTTCTGT
GGGCGGTGCCGCCGAGCGCGTTGAGCGTCGTCAGCGACAGCAGCAGCAAG
CCCCACGAGGACGTTCCCGCTCTCAGTCCCGTTCGCGCCACCCGCAAATA
CAGCGTGTGGACAGAGCACGTTCCCAAAGCCGTGGACGCAGCATTGGGCG
TTCCCAGAGCCGCAATCGCGATCGCTCCGCCCAGGGCCGAGTTCCAGTGA
AACAGCGGCTTTCAGTCAAGCACCGCCTTGGCGTGCGAACCGGCCAGAGA
AACAACCAGGCCAAGATCCCACCGCAGCGCCGGGCACCAAGCCAAATTCG
AGGTGTGGCAGGCGGACGGGTCGAGAAGCGTCGTAGTGCTCAGATTTCCC
AAAAGAAGGGAGTTTCCGCCTCGATTGCCGGACGTCAAGGACGACCACGT
AGAAGATCTGTTGCAAGAAACGCTGCTTCTAGCAGTGGGGCAGTTAACAA
TTCTGCTTCTGCTCGTCGCTCACGCTCGCGCAATCGTGCTGCCGCCGTCG
CTGCTGCCGCTATCGCCGCTACTGTTCAGGGCCGGGCTAATCCTCGCCAG
AGACGCGGACGCAGTGCAGGCGCTGCCAAGGGCAAGATCATCAGAAATGG
TAAAGCTGACAAAAACGCGAAGGTCAAGGCGACAAACGGTGTCAAAAGTG
GCCCGCAGCAACAGGTTCGACGGGGACGCAGTCGTAGTCGTAAGCCTACA
GGTAAAAGCGAGACAAGTGGCCAGGAGACAAACCGGACTGGATCTGGAAA
TAGGCACTTGAAACTCAAAATTGACATATTTTTGTCTCTACTTTCTACTT
ACACTCTTGATGCAAGCTTTCTAGACCAT

BO29176.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 00:48:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-RD 948 CG9775-PD 1..945 17..961 4725 100 Plus
CG9775-RE 1266 CG9775-PE 331..1170 17..856 4185 99.9 Plus
CG9775-RC 1266 CG9775-PC 331..1170 17..856 4185 99.9 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:48:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-RD 2400 CG9775-RD 1032..1976 17..961 4725 100 Plus
CG9775-RE 1966 CG9775-RE 732..1571 17..856 4185 99.9 Plus
CG9775-RC 1740 CG9775-RC 506..1345 17..856 4185 99.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 00:48:06
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4639018..4639556 555..17 2695 100 Minus
3R 32079331 3R 4638434..4638841 961..554 2040 100 Minus
Blast to na_te.dros performed on 2014-11-27 00:48:06 has no hits.

BO29176.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-08-26 13:54:50 Download gff for BO29176.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1048..1992 17..963 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 04:34:29 Download gff for BO29176.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1032..1976 17..963 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 02:10:02 Download gff for BO29176.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1032..1976 17..963 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 02:10:02 Download gff for BO29176.complete
Subject Subject Range Query Range Percent Splice Strand
3R 4639018..4639556 17..555 100   Minus
3R 4638432..4638839 556..963 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 04:34:29 Download gff for BO29176.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 464740..465278 17..555 100   Minus
arm_3R 464154..464561 556..963 99 <- Minus

BO29176.pep Sequence

Translation from 16 to 979

> BO29176.pep
MRADLVASGNAARNRRSGSSMRNVPATNGGGGGLRQRLGQRRPSVGGAAE
RVERRQRQQQQAPRGRSRSQSRSRHPQIQRVDRARSQSRGRSIGRSQSRN
RDRSAQGRVPVKQRLSVKHRLGVRTGQRNNQAKIPPQRRAPSQIRGVAGG
RVEKRRSAQISQKKGVSASIAGRQGRPRRRSVARNAASSSGAVNNSASAR
RSRSRNRAAAVAAAAIAATVQGRANPRQRRGRSAGAAKGKIIRNGKADKN
AKVKATNGVKSGPQQQVRRGRSRSRKPTGKSETSGQETNRTGSGNRHLKL
KIDIFLSLLSTYTLDASFLDH

BO29176.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 07:59:50
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-PD 315 CG9775-PD 1..315 1..315 1552 100 Plus
CG9775-PE 421 CG9775-PE 111..392 1..282 1378 99.3 Plus
CG9775-PC 421 CG9775-PC 111..392 1..282 1378 99.3 Plus
CG9775-PA 421 CG9775-PA 111..392 1..282 1378 99.3 Plus
CG9915-PC 820 CG9915-PC 123..433 10..296 192 27.7 Plus