Clone FMO01001 Report

Search the DGRC for FMO01001

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:1
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpn6-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01001.5prime Sequence

1195 bp (997 high quality bases) assembled on 2008-02-20

> FMO01001.5prime
TTAAAACGAAGTTATCAGTCGACATGGCCGGAGCAACACTTTTCGAGCGT
GCCCAGGCATTGTCCAGCGTGAATCGCGAGGAGCAGGATAGTTCGCTGCT
GAACAAACTGGTCCGCGACCAGGAGGGCGCCGAGAACGATGAGGAGCGCA
TCCGAATCAAGGAGCAGGGCATTCTGCAGCAGGGCGAGCTCTACAAGCAG
GAGGGCAAGGCCAAGGAGCTGGCCGATCTCATCAAGGTGACGCGTCCGTT
CCTCAGCTCGATCAGCAAGGCCAAGGCGGCCAAGCTGGTGCGTTCGCTGG
TGGACATGTTCCTGGACATGGACGCGGGCACAGGCATTGAGGTTCAATTG
TGTAAAGACTGCATTGAGTGGGCCAAACAGGAGAAGCGCACATTTCTTCG
CCAATCGCTGGAAGCTCGTCTGATTGCCTTATATTTTGATACTGCTTTGT
ACACGGAGGCCTTGGCTCTGGGTGCCCAATTGCTGCGCGAGCTGAAAAAG
CTGGATGACAAGAATCTGCTGGTGGAAGTGCAGCTGCTGGAGAGCAAAAC
CTATCACGCACTGAGCAACCTGCCCAAGGCTAGGGCCGCCCTCACCTCAG
CCCGCACCACGGCCAATGCTATCTACTGTCCGCCAAAGGTGCAAGGCGCA
CTGGATCTTCAGTCCGGCATCCTACATGCGGCTGATGAGCGTGACTTTAA
GACCGCATTCTCCTATTTCTACGAGGCCTTTGAAGGATTCGACAGCGTGG
ACAGCGTCAAGGCCTTGACCTCGCTTAAATACATGTTGCTGTGCAAAATC
ATGTTGGGACAGTCCGATGATGTCAACCAGCTCGTCAGTGGAAAGCTGGC
TATTACCTATTCGGGCCGCGATATAGATGCTATGAATCAGTGGCTGAGCT
TCACACAAACGTTCCCTGACGACTTCCAGGCTGCCCTCAAGGAATACAAA
AGGAGCTCGCGAGGATGTGATGTGCAGCGCATTTGGGCACGTATACGACA
CCATGATGAGCAACTGTGCGCATCATGACCTACTCTCGTGTGCAGTCGCA
TGTGCTGAAGCATCACTGCCATGCCAGTGAAAGACTGTTCCAATGATTCT
GACAAGGTTCACCGCATTTCGATCGGTGAGGAATCGATGTTCAGAGTCCC
GGTCAGACCTGGACCGCGTCCTGAACCTATCGAAGGATTGGTTAT

FMO01001.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:26:44
Subject Length Description Subject Range Query Range Score Percent Strand
Rpn6-RC 1662 CG10149-RC 74..1111 24..1045 4780 98.3 Plus
Rpn6-RB 1827 CG10149-RB 239..1276 24..1045 4780 98.3 Plus
Rpn6-RA 1612 CG10149-RA 126..1163 24..1045 4780 98.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:26:41
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14751144..14751653 849..340 2550 100 Minus
2R 25286936 2R 14751714..14752033 343..24 1600 100 Minus
2R 25286936 2R 14750831..14750996 1005..848 415 94.6 Minus
Blast to na_te.dros performed on 2014-11-28 21:26:43 has no hits.

FMO01001.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:39:58 Download gff for FMO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10149-RB 272..1340 12..1058 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:32:51 Download gff for FMO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpn6-RA 119..1180 15..1058 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:22:55 Download gff for FMO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpn6-RA 119..1180 15..1058 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:22:55 Download gff for FMO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 14751716..14752047 12..341 98   Minus
2R 14751145..14751651 342..848 100 <- Minus
2R 14750783..14750995 849..1045 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:32:51 Download gff for FMO01001.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10639221..10639552 12..341 98   Minus
arm_2R 10638650..10639156 342..848 100 <- Minus
arm_2R 10638288..10638500 849..1045 91 <- Minus