Clone FMO01003 Report

Search the DGRC for FMO01003

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:3
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAP-1sigma-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01003.5prime Sequence

512 bp (512 high quality bases) assembled on 2008-02-20

> FMO01003.5prime
TTAAAACAAAGTTATCAGTCGACATGATGCTTTTCATGCTGCTGTTTAGT
CGGCAGGGCAAACTGCGGTTACAAAAGTGGTACATGGCCTATCCGGATAA
GGTGAAAAAGAAGATCACCCGGGAACTGGTCACTACGATACTGGCCCGCA
AGCCCAAAATGTGCTCCTTTCTGGAGTGGAAGGACTGCAAAATTGTCTAC
AAAAGGTATGCCAGCTTGTATTTCTGTTGCGCCATCGAGCAGAACGACAA
CGAACTGCTGACACTGGAGATCATTCATCGCTATGTGGAGCTGTTGGATA
AGTACTTCGGCAGCGTCTGCGAGCTGGACATTATCTTTAACTTTGAAAAA
GCATACTTTATCCTGGATGAGCTGCTCATTGGCGGCGAAATCCAGGAGAC
GTCCAAAAAGAACGTACTTAAGGCGATTGCCTCGCAGGATCTGCTCCAAG
AGGATGAGACCCCGCAGAGTTTCTTCGACGATCACGGCCTGGGCGCAAGC
TTTCTAGACCAT

FMO01003.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:11
Subject Length Description Subject Range Query Range Score Percent Strand
AP-1sigma-RA 1079 CG5864-RA 146..616 24..494 2355 100 Plus
AP-1sigma-RC 795 CG5864-RC 146..576 24..454 2155 100 Plus
AP-1sigma-RB 1181 CG5864-RB 146..576 24..454 2155 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:09
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23959031..23959212 26..207 910 100 Plus
3R 32079331 3R 23959456..23959594 315..453 695 100 Plus
3R 32079331 3R 23959278..23959390 204..316 565 100 Plus
3R 32079331 3R 23962049..23962092 451..494 220 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:23:10 has no hits.

FMO01003.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:39:59 Download gff for FMO01003.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5864-RA 143..619 24..502 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:01:00 Download gff for FMO01003.5prime
Subject Subject Range Query Range Percent Splice Strand
AP-1sigma-RA 146..622 24..502 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:57:40 Download gff for FMO01003.5prime
Subject Subject Range Query Range Percent Splice Strand
AP-1sigma-RA 146..622 24..502 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:57:40 Download gff for FMO01003.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23962051..23962098 453..502 94   Plus
3R 23959456..23959593 315..452 100 -> Plus
3R 23959280..23959388 206..314 100 -> Plus
3R 23959032..23959210 24..205 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:01:00 Download gff for FMO01003.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 19787773..19787820 453..502 94   Plus
arm_3R 19785178..19785315 315..452 100 -> Plus
arm_3R 19785002..19785110 206..314 100 -> Plus
arm_3R 19784754..19784932 24..205 98 -> Plus