Clone FMO01010 Report

Search the DGRC for FMO01010

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:10
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpL19-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01010.5prime Sequence

650 bp (650 high quality bases) assembled on 2008-03-07

> FMO01010.5prime
AAAAAACAAAGTTATCAGTCGACATGAGTTCTCTAAAGCTCCACAAGAGG
CTCGCAGCCTCCGTGCTGCGATGCGGCAAGAAGAAGGTCTGGTTGGATCC
CAATGAAATCAACGAGATCGCTAACACAAACTCGCGTCAGAACATTCGCA
AGCTTATCAAGGATGGTCTGATCATCAAGAAGCCCGTCGTGGTCCACTCC
CGTTACCGTGTGCGCAAAAACACCGAGGCCCGCCGCAAGGGACGTCACTG
CGGATTCGGAAAGCGTAAGGGTACTGCGAACGCCCGCATGCCTACCAAGC
TGCTGTGGATGCAGCGCCAGCGCGTTCTGCGCCGCCTGTTGAAGAAGTAC
CGCGACAGCAAGAAGATTGACAGGCACCTGTACCACGACCTGTACATGAA
GTGCAAGGGTAACGTATTCAAGAACAAGCGCGTCCTCATGGAGTACATCC
ACAAGAAGAAGGCTGAGAAGCAGCGCAGCAAGATGCTGGCTGATCAGGCC
GAGGCTCGCCGACAGAAGGTGCGTGAGGCCCGCAAGCGCCGCGAGGAGCG
TATTGCCACCAAGAAGCAGGAGCTCATCGCCCTGCATGCTAAGGAGGACG
AGATCGCTGCCAAGGCCGCCACCGCGGGTCACGCAAGCTTTCTAGACCAT

FMO01010.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:28:43
Subject Length Description Subject Range Query Range Score Percent Strand
RpL19-RB 755 CG2746-RB 36..645 23..632 3035 99.8 Plus
RpL19-RA 1361 CG2746-RA 74..683 23..632 3035 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:28:41
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24968555..24969051 632..136 2485 100 Minus
2R 25286936 2R 24969116..24969226 137..27 540 99.1 Minus
Blast to na_te.dros performed on 2014-11-28 23:28:42 has no hits.

FMO01010.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:35 Download gff for FMO01010.5prime
Subject Subject Range Query Range Percent Splice Strand
CG2746-RB 25..650 15..642 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:25:17 Download gff for FMO01010.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL19-RA 67..692 15..642 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:13:31 Download gff for FMO01010.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL19-RA 67..692 15..642 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:13:31 Download gff for FMO01010.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24969118..24969224 29..135 99 <- Minus
2R 24968546..24969051 136..642 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:25:17 Download gff for FMO01010.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 20856641..20856747 29..135 99 <- Minus
arm_2R 20856069..20856574 136..642 99 <- Minus