Clone FMO01012 Report

Search the DGRC for FMO01012

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:12
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAnnIX-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01012.5prime Sequence

1045 bp (929 high quality bases) assembled on 2008-02-20

> FMO01012.5prime
ATAAAACAAAGTTATCAGTCGACATGAGTTCCGCTGAGTACTACCCATTC
AAGTGCACACCCACTGTCTACCCGGCGGATCCCTTCGATCCCGTCGAGGA
TGCGGCTATTCTGCGCAAGGCGATGAAAGGCTTCGGCACCGACGAGAAGG
CCATCATCGAGATCCTGGCCAGGCGTGGCATCGTCCAGCGTTTGGAGATC
GCTGAGGCGTTCAAGACCTCGTACGGCAAGGACCTGATCTCGGACCTCAA
GTCCGAACTGGGCGGCAAATTCGAGGATGTTATCCTGGCTCTGATGACGC
CGCTGCCCCAGTTCTATGCCCAGGAGCTGCACGACGCCATCTCGGGACTG
GGAACCGACGAGGAGGCCATCATCGAGATCCTCTGCACGCTGTCCAACTA
CGGCATCAAGACCATTGCCCAGTTCTACGAGCAGAGCTTCGGCAAGTCCC
TAGAGTCCGACCTGAAGGGCGACACCAGTGGCCACTTCAAGCGGCTGTGT
GTCTCGCTCGTCCAGGGCAACCGGGATGAGAACCAGGGCGTGGACGAGGC
CGCGGCCATCGCCGATGCCCAGGCTCTGCACGACGCCGGTGAGGGACAGT
GGGGCACAGATGAGTCCACCTTCAACTCGATCCTGATCACCCGCTCCTAC
CAGCAGCTGCGCCAGATCTTCCTCGAATACGAGAATCTGTCGGGCAACGA
CATCGAGAAGGCCATCAAGCGGGAGTTTAGCGGCTCCGTGGAGAAGGGTT
TCCTGGCCATCGTCAAGTGCTGCAAGTCCAAGATCGACTACTTTTCGGAG
CGCCTGCACGACTCAATGGGCCGGCATGGGCACCAAGGACAAGACGCTGA
TCCGCATCATTGTCAGCCGGTCGGAGATCGATCTGGGTGACATCAGGGAT
GCATTCCAGAACAAGTACGGCAAGAGCTTGTGTCCTGATCAAGGACGACC
TTCTCCGGAGACTACAGCTACGTCTTGCAGTGCCTGGCCCTCTACGCAAG
GCTTTCTAGAACCATTCGGTTGGCGCCGCCGGGGGCCCAGGTAGT

FMO01012.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:04
Subject Length Description Subject Range Query Range Score Percent Strand
AnxB9-RB 1184 CG5730-RB 70..1035 24..989 4680 99.2 Plus
AnxB9-RD 1300 CG5730-RD 186..1151 24..989 4680 99.2 Plus
AnxB9-RF 1457 CG5730-RF 95..1020 24..948 4485 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:02
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 21068067..21068777 52..762 3540 99.9 Plus
3R 32079331 3R 21068837..21069004 762..930 765 98.2 Plus
X 23542271 X 16418705..16418779 398..324 225 86.7 Minus
3R 32079331 3R 21070731..21070768 952..989 190 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:23:03 has no hits.

FMO01012.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:39:56 Download gff for FMO01012.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5730-RD 190..1179 16..1006 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:00:54 Download gff for FMO01012.5prime
Subject Subject Range Query Range Percent Splice Strand
AnxB9-RD 178..1167 16..1006 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:57:38 Download gff for FMO01012.5prime
Subject Subject Range Query Range Percent Splice Strand
AnxB9-RD 178..1167 16..1006 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:57:38 Download gff for FMO01012.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 21068838..21069019 763..943 96 -> Plus
3R 21068069..21068777 54..762 99 -> Plus
3R 21067471..21067499 25..53 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:00:54 Download gff for FMO01012.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 16894560..16894741 763..943 96 -> Plus
arm_3R 16893791..16894499 54..762 99 -> Plus
arm_3R 16893193..16893221 25..53 100 -> Plus