Clone FMO01014 Report

Search the DGRC for FMO01014

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:14
Vector:pMK33-CFH-BD
Associated Gene/TranscriptUbc-E2H-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01014.3prime Sequence

873 bp (-720 high quality bases) assembled on 2008-02-20

> FMO01014.3prime
GTTTTTTTTTTTTTTAAAAAAAAAAAGAAACCAACACCCACCCCCAAATG
AGTGGGTAGGGGTTGGTGGTGTTTTTATTTATTTTATTTAATAATATTAA
ATAATATCACCTCCCCCCCCCCCGCCGCGCCCCCGCGGGCAGGAGGGAGA
AAAAAAAAAAAAAAAAAAAAAATTTCACTTCCGTAGCTGGGTTTTTTTTT
TTTTCATTTGTTGGGGGGGGGGGAGGCTGGTGTTTTTGTTTTTTTTTTTT
TTTTTTTTGCCCCCGCCCCCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTA
GAAAAAAAAAAAAAAATTTTTTTCCCCCCCACAAAAAAAAAAAAATTTAT
CCTCTTTCTGTGTGGAAAAAAAAAAAAAAAAGCCCCCCCCCCCCTTTTAT
TTGAGGACCCCCCCCAAACGGGTTTGTTTTTTTATTTAACCACCGCCCCC
CACAAAAAAAAAAATTATTTTTTTTGTGTGTAAAGTAAAAGAGCCCCCCG
CGGGGGGGGGGGGTTTTTAAAAATTAAAAGGCCGGACCTCCTCGGGGGGG
GGGGTTTTTTAAAATTTTTTGGGGGGGGGGGGGTTTTTTTTTTAAAAAAA
AAAAAAAAAATTTTTTGGGTTAAAAAAAGAAAAAATTTTTTTTTGGGGGG
GAAAAAAAAGGACCCTTTTTTTTCCCACGGGGCCCTTTTTGGGGGGGGGT
TTTTTTTGGGGGGGGGGGGAAAAAACTTGGGGGGGGGATTTTTTGGGGGG
CCCCCCCCGGGGGGGGGCCCCCCTGGGGTTTGTTTTGGAAAGGTTAAAAA
ATTTTTTCCCGGGTTGATGCGGGCCTGGGGGGGACATTGATGAAATTCTC
TTTTATTTTTCTTTGGAAGGTTA

FMO01014.3prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 21:45:49 has no hits.
Blast to na_all.dmel.RELEASE6 performed on 2014-11-28 21:45:47 has no hits.
Blast to na_te.dros performed 2014-11-28 21:45:48
Subject Length Description Subject Range Query Range Score Percent Strand
micropia 5461 micropia DMDM11 5461bp 2362..2398 771..807 113 78.4 Plus

FMO01014.3prime Sim4 Records

Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 22:32:16 has no hits.
Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 22:32:16 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 00:44:23 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 00:44:23 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2008-05-23 17:42:42 has no hits.